2Department of Orthopaedic Surgery, the First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, China
3Department of outpatient, Chongqing Zhongshan Hospital, Chongqing, 400013, China
4Department of Orthopaedic Surgery, the Second Affiliated Hospital of Baotou Medical College of Inner Mongolia University of Science and Technology, Baotou, 014030, China
Methods: Using isolated human MSCs and sections of whole femoral heads, we analyzed the proliferative capacity and osteogenic, angiogenic and adipogenic differentiation of human MSCs at the proximal femur.
Results: The proliferation of MSCs from patients with corticosteroid-induced ONFH is decreased. The down-regulated expression of BMP2, BMP7, BMP9 and Osteopontin provides supportive evidence corticosteroid-induced inhibition of osteogenesis. Down-regulation of HIF1α, VEGF and VWF by glucocorticoids is directly responsible for decreased angiogenesis. Over-expression of PPARγ2 and (442)aP2 suggests that the corticosteroids may induce MSCs to differentiate into adipocytes.
Conclusions: Our findings suggest steroids may reduce the proliferative activity of MSCs, down-regulate the expression of osteoblast differentiation factors such as BMP2, BMP7, BMP9 and OPN, decrease angiogenesis by suppressing HIF1α and VEGF, and upregulate adipocyte transcription factor expression such as PPARγ2 and (442)aP2.
Keywords: Osteonecrosis; Mesenchymal Stromal Cells; Steroids; Bone Morphogenetic Proteins; Hypoxia-induciblefactor1α
Human mesenchymal stromal cells (MSCs) are multipotent progenitors which undergo self-renewal and differentiate into osteogenic, angiogenic and adipogenic lineages [8]. It is suggested that ONFH is a disease of MSCs, due to abnormal proliferation or differentiation of MSCs [9]. Osteogenic differentiation is a sequential cascade that recapitulates most of the molecular events occurring during bone development and remodeling. Bone morphogenetic proteins (BMPs) play an important role during development and have been shown to regulate stem cell proliferation and osteogenic differentiation [10]. BMP2, 7 and 9 are the most potent BMPs among the 14 types of BMPs in inducing osteogenic differentiation of MSCs [11]. Normal and pathological bone physiology is inexorably tied to angiogenesis. The vasculature plays an important role for the mechanism of coupling resorption by osteoclasts and bone formation by osteoblasts [11]. Angiogenesis, the development of a microvascular network for blood supply, is critical for the development, remodeling and healing of bone [11-13]. Hypoxia can induce both apoptosis as well as necrosis of cells and is associated with vascular disease [12]. Hypoxia-inducible factor1α (HIF1α) is a well established regulator of angiogenic cascade, which usually coordinates with skeletal development [11,14]. Vascular endothelial growth factor (VEGF), transcriptionally targeted gene of HIF1α, is a key regulator of vasculogenesis in the embryo and angiogenesis in adult tissues [11,15,16]. Thus, it appeared promising to investigate the role of angiogenic factors such as HIF1α and VEGF. Small vessel occlusion by fatty emboli and the impedance of sinusoidal blood flow secondary to a rise in intraosseous pressure due to fatty infiltration following steroid therapy. In addition, steroid stimulates MSCs differentiation into adipocytes as well as the accumulation of fat in the marrow while suppressing cell differentiation into osteoblasts [17]. Peroxisome proliferator activated receptor γ2 (PPARγ2) gene expression destines cells for adipocyte differentiation [18,19].
Here, we investigate if the pathogenesis of steroid-induced osteonecrosis is associated with decreased proliferative capacity and abnormal differentiation of human MSCs at the proximal femur. The proliferation of cultured human MSCs in patients with corticosteroid-induced ONFH is depressed. We report the identification of abnormal differentiation in isolated MSCs and sections of whole femoral heads obtained during total hip replacement for glucocorticoid-induced osteonecrosis. The decreased expression of BMP2, BMP7, BMP9 and Osteopontin provide supportive evidence corticosteroid-induced inhibition of osteogenesis. Down-regulation of HIF1α, VEGF and VWF by glucocorticoids is directly responsible for disturbed angiogenesis. Over-expression of PPARγ2 and (442)aP2 suggests the corticosteroid-induced adipogenic differentiation. Taken together, our findings should not only expand our understanding of the molecular basis behind steroid-induced osteonecrosis, but also provide an opportunity to harness proliferative capacity and differentiation of MSCs in regenerative medicine.
(A) The transcription expression of BMP2, BMP7, BMP9 and OPN in MSCs of the ONFH group and the control group. Total RNA was isolated from subconfluent cells and subjected to semi-quantitative PCR (sqPCR) analysis using primers specific for human BMP2, BMP7, BMP9 and OPN. Expected PCR products were resolved on agarose gels (a). The signal intensities of the expected products were quantitatively analyzed using the NIH ImageJ software (b). Each PCR condition was done in triplicate. Representative results are shown.
(B) The protein expression of BMP2, BMP7, BMP9 and OPN in MSCs of the ONFH group and the control group. Tissues were prepared in the same fashion as described in (a). Tissues were lyzed and subjected to SDS-PAGE and Western blotting with anti-BMP2, anti-BMP7, anti-BMP9 and anti-OPN antibodies. Expression levels of β-actin was used to assess equal loading of total lysate.
(C) Immunohistochemical staining of BMP2, BMP7 and BMP9 in the sections of the ONFH and control groups. Bone marrow was retrieved in a similar fashion as shown in Figure 1C. The retrieved tissues were subjected to BMP2, BMP7 or BMP9 antibody immunohistochemical staining. Isotype IgG was used as a negative control (not shown). Representative results are shown. Magnification, 40x.
(D) Immunofluorescent staining results also confirmed that osteopontin protein was significantly decreased in ONFH group relative to the control. Each assay condition was done in triplicate. * P < 0.05; ** p < 0.001.
human BMP2 Fwd: |
ACTCGAAATTCCCCGTGACC |
human BMP2 Rev: |
CCACTTCCACCACGAATCCA |
human BMP7 Fwd: |
GACTTCAGCCTGGACAACGA |
human BMP7 Rev: |
TGTAGGGGTAGGAGAAGCCC |
human BMP9 Fwd: |
CTGTGGAGAGCCACAGGAAG |
human BMP9 Rev: |
CTCCTTTTCCGCCTGGCTAA |
human OPN Fwd: |
CATACAAGGCCATCCCCGTT |
human OPN Rev: |
TGGGTTTCAGCACTCTGGTC |
human HIF1a Fwd: |
TGCATCTCCATCTCCTACCC |
human HIF1a Rev: |
CGTTAGGGCTTCTTGGATGA |
human VEGF Fwd: |
CCCACTGAGGAGTCCAACAT |
human VEGF Rev: |
TTTCTTGCGCTTTCGTTTTT |
human vWF Fwd: |
CCACTTGCCACAACAACATC |
human vWF Rev: |
TGGACTCACAGGAGCAAGTG |
human PPARγ2 Fwd: |
ATCTTTCAGGGCTGCCAGT |
human PPARγ2 Rev: |
GGAGGCCAGCATTGTGTAA |
human (442)aP2 Fwd: |
GGTGCAGAAGTGGGATGG |
human (442)aP2 Rev: |
TGGCTCATGCCCTTTCAT |
human GAPDH Fwd: |
GCATGGCCTTCCGTGTCCCC |
human GAPDH Rev: |
GAGGGCAATGCCAGCCCCAG |
(B) The protein expression of HIF1&alpha, VEGF and vWF in MSCs of the ONFH group and the control group. Tissues were prepared in the same fashion as described in (a). Tissues were lyzed and subjected to SDS-PAGE and Western blotting with anti-HIF1&alpha, anti-VEGF and anti-vWF antibodies. Expression levels of β-actin was used to assess equal loading of total cell lysate.
(C) Immunohistochemical staining of HIF1&alpha, VEGF and vWF in the sections of the ONFH and control groups. Bone marrow was retrieved in a similar fashion as shown in Figure 1. The retrieved tissues were subjected to HIF1&alpha, VEGF or vWF antibody immunohistochemical staining. Isotype IgG was used as a negative control (not shown). Representative results are shown. Magnification, 40x.
(D) vWF protein expression level was also tested by Immunofluorescence and vWF was notably decreased in group of ONFH relative to the control. Each assay condition was done in triplicate. * P < 0.05; ** p < 0.001.
Osteogenic differentiation is a sequential cascade that recapitulates most of the molecular events occurring during embryonic skeletal development [10]. BMPs belong to the transforming growth factor β (TGFβ) superfamily and consist of at least 14 members in humans [8]. Genetic disruptions of BMPs have resulted in various skeletal and extraskeletal abnormalities during development [11]. BMP2, 7 and 9 are the most potent BMPs in inducing osteogenic differentiation of MSCs by regulating several important downstream targets during BMPs-induced osteoblast differentiation [8,11]. Our results confirmed that corticosteroid down-regulates the expression of BMP2, 7 and 9, thus reduces late osteogenic markers and inhibits osteogenesis of MSCs.
The process of bone development and repair depends on adequate formation of new capillaries from existing blood vessel [11,12]. It has been reported that angiogenesis and osteogenesis are well coordinated processes during bone development [11]. We have demonstrated that BMP9 directly upregulates HIF1α expression in MSCs, which in turn induces both osteogenic factors and angiogenic factor VEGF [11]. Thus, potent osteogenic factors, such as BMP9, may induce a tightly-regulated convergence of osteogenic and angiogenic signaling in MSCs, and subsequently lead to efficient bone formation. HIF1 regulates target genes such as VEGF and vWF that mediate adaptive responses, such as angiogenesis, to reduced oxygen availability [11]. HIF1α polymorphisms are associated with idiopathic ONFH in men; and variations in HIF1α play a role in the pathogenesis and risk factor for ONFH [27]. Osteoblasts derived from femoral heads have been found to exhibit downregulation of VEGF within 24 hours of incubation with corticosteroid [28]. Down-regulation of HIF1α, VEGF and vWF by corticosteroid is directly responsible for disturbed angiogenesis resulting in the defects in capillary architecture, which eventually lead to osteonecrosis.
Corticosteroid can induce differentiation of MSCs into adipose cells. Since adipocytes and osteoblasts share a common progenitor pool, when exogenous stimulators shift the differentiation of
(A) The transcription expression of PPARγ2 and (442)aP2 in MSCs of the ONFH group and the control group. Total RNA was isolated from subconfluent cells and subjected to semi-quantitative PCR (sqPCR) analysis using primers specific for human PPARγ2 and (442)aP2. Expected PCR products were resolved on agarose gels (a). The signal intensities of the expected products were quantitatively analyzed using the NIH ImageJ software (b). Each PCR condition was done in triplicate. Representative results are shown.
(B) The protein expression of PPARγ2 and (442)aP2 in MSCs of the ONFH group and the control group. Tissues were prepared in the same fashion as described in (a). Tissues were lyzed and subjected to SDS-PAGE and Western blotting with anti- PPARγ2 and anti-(442)aP2 antibodies. Expression levels of β-actin was used to assess equal loading of total cell lysate.
(C) Immunohistochemical staining of PPARγ2 and (442)aP2 in the sections of the ONFH and control groups. Bone marrow was retrieved in a similar fashion as shown in Figure 1. The retrieved tissues were subjected to PPARγ2 or (442)aP2 antibody immunohistochemical staining. Isotype IgG was used as a negative control (not shown). Representative results are shown. Magnification, 40x.
(D) Immunofluorescent results displayed that (442)aP2 protein was significantly increased in ONFH group relative to the control. (E) Detection of the concentration of triglyceride in bone tissues by TG reagent kit. The TG concentration of the control group was 0.87 ± 0.03mmol/l and the concentration of the ONFH group was 9.07 ± 0.28mmol/L. Each assay condition was done in triplicate. * P < 0.05; ** p < 0.001.
- Mont MA, Jones LC, Hungerford DS. Nontraumatic osteonecrosis of the femoral head: ten years later. J Bone Joint Surg Am. 2006; 88(5):1117- 1132.
- Mont MA, Marulanda GA, Jones LC, Saleh KJ, Gordon N, Hungerford DS, et al. Systematic analysis of classification systems for osteonecrosis of the femoral head. J Bone Joint Surg Am. 2006; 88 Suppl 3:16-26.
- Bradbury G, Benjamin J, Thompson J, Klees E, Copeland J. Avascular necrosis of bone after cardiac transplantation. Prevalence and relationship to administration and dosage of steroids. J Bone Joint Surg Am 1994; 76(9):1385–1388.
- Hungerford DS, Lennox DW. The importance of increased intraosseous pressure in the development of osteonecrosis of the femoral head: implications for treatment. Orthop Clin North Am. 1985: 16(4):635– 654.
- Jones LC, Mont MA, Le TB, Petri M, Hungerford DS, Wang P, et al. Procoagulants and osteonecrosis. J Rheumatol. 2003; 30(4):783-791.
- Wang GJ. The Frank Stinchfield Award paper. Improvement of femoral head blood flow in steroid-treated rabbits using lipid-clearing agent. Hip. 1987; 87–93.
- Wang GJ, Cui Q, Balian G. The Nicolas Andry award. The pathogenesis and prevention of steroid-induced osteonecrosis. Clin Orthop Relat Res. 2000; 370:295–310.
- Deng ZL, Sharff KA, Tang N, Song WX, Luo J, Luo X, et al. Regulation of osteogenic differentiation during skeletal development. Front Biosci. 2008; 13:2001-2021.
- Gangji V, Hauzeur JP, Schoutens A, Hinsenkamp M, Appelboom T, Egrise D. Abnormalities in the replicative capacity of osteoblastic cells in the proximal femur of patients with osteonecrosis of the femoral head. J Rheumatol. 2003; 30(2):348-351.
- Olsen BR, Reginato AM, Wang W. Bone development. Annu Rev Cell Dev Biol. 2000; 16:191-220.
- Hu N, Jiang D, Huang E, Liu X, Li R, Liang X, et al. BMP9-regulated angiogenic signaling plays an important role in the osteogenic differentiation of mesenchymal progenitor cells. J Cell Sci. 2013; 126(Pt 2):532-41. doi: 10.1242/jcs.114231.
- Streeten EA, Brandi ML. Biology of bone endothelial cells. Bone Miner. 1990; 10(2):85–94.
- Colnot C, Thompson Z, Miclau T, Werb Z, Helms JA. Altered fracture repair in the absence of MMP9. Development. 2003; 130(17):4123– 4133.
- Majmundar AJ, Wong WJ, Simon MC. Hypoxia-inducible factors and the response to hypoxic stress. Mol Cell. 2010; 40(2):294-309.
- Tatsuyama K, Maezawa Y, Baba H, Imamura Y, Fukuda M. Expression of various growth factors for cell proliferation and cytodifferentiation during fracture repair of bone. Eur J Histochem. 2000; 44(3):269–278.
- Komatsu DE, Hadjiargyrou M. Activation of the transcription factor HIF-1 and its target genes, VEGF, HO-1, iNOS, during fracture repair. Bone. 2004; 34(4): 680-688.
- Cui Q, Wang GJ, Balian G. Steroid-induced adipogenesis in a pluripotential cell line from bone marrow. J Bone Joint Surg Am. 1997; 79(7):1054–1063.
- Mueller E, Drori S, Aiyer A, Yie J, Sarraf P, Chen H, et al. Genetic analysis of adipogenesis through peroxisome proliferator-activated receptor gamma isoforms. J Biol Chem. 2002; 277(44):41925–41930.
- Shao D, Lazar MA. Peroxisome proliferator activated receptor gamma, CCAAT/enhancer-binding protein alpha, and cell cycle status regulate the commitment to adipocyte differentiation. J Biol Chem. 1997; 272(34):21473–21478.
- Wang BL, Sun W, Shi ZC, Lou JN, Zhang NF, Shi SH, et al. Decreased proliferation of mesenchymal stem cells in corticosteroid-induced osteonecrosis of femoral head. Orthopedics. 2008; 31(5):444.
- Suh KT, Kim SW, Roh HL, Youn MS, Jung JS. Decreased osteogenic differentiation of mesenchymal stem cells in alcohol-induced osteonecrosis. Clin Orthop Relat Res. 2005; (431):220-225.
- Sakaguchi M, Tanaka T, Fukushima W, Kubo T, Hirota Y. Impact of oral corticosteroid use for idiopathic osteonecrosis of the femoral head: a nationwide multicenter case-control study in Japan. J Orthop Sci. 2010; 15(2):185-191. doi: 10.1007/s00776-009-1439-3.
- Hernigou P, Beaujean F, Lambotte JC. Decrease in the mesenchymal stem-cell pool in the proximal femur in corticosteroid-induced osteonecrosis. J Bone Joint Surg Br. 1999; 81(2):349-355.
- Weinstein RS, Nicholas RW, Manolagas SC. Apoptosis of osteocytes in glucocorticoid-induced osteonecrosis of the hip. J Clin Endocrinol Metab. 2000; 85(8):2907-2912.
- Lee JS, Lee JS, Roh HL, Kim CH, Jung JS, Suh KT. Alterations in the differentiation ability of mesenchymal stem cells in patients with nontraumatic osteonecrosis of the femoral head: comparative analysis according to the risk factor. J Orthop Res. 2006; 24(4):604-609.
- Yin L, Li YB, Wang YS. Dexamethasone-induced adipogenesis in primary marrow stromal cell cultures: mechanism of steroid-induced osteonecrosis. Chin Med J (Engl). 2006; 119(7):581-588.
- Hong JM, Kim TH, Chae SC, Koo KH, Lee YJ, Park EK, et al. Association study of hypoxia inducible factor 1alpha (HIF1alpha) with osteonecrosis of femoral head in a Korean population. Osteoarthritis Cartilage. 2007; 15(6):688-694.
- Varoga D, Drescher W, Pufe M, Groth G, Pufe T. Differential expression of vascular endothelial growth factor in glucocorticoid-related osteonecrosis of the femoral head. Clin Orthop Relat Res. 2009; 467(12):3273-3282. doi: 10.1007/s11999-009-1076-3.
- Li X, Jin L, Cui Q, Wang GJ, Balian G. Steroid effects on osteogenesis through mesenchymal cell gene expression. Osteoporos Int. 2005;16(1):101-108.
- Kitajima M, Shigematsu M, Ogawa K, Sugihara H, Hotokebuchi T. Effects of glucocorticoid on adipocyte size in human bone marrow. Med Mol Morphol. 2007; 40(3):150-156.
- Canalis E, Delany AM. Mechanisms of glucocorticoid action in bone. Ann N Y Acad Sci. 2002; 966:73–81.
- O’Brien CA, Jia D, Plotkin LI, Bellido T, Powers CC, Stewart SA, et al. Glucocorticoids act directly on osteoblasts and osteocytes to induce their apoptosis and reduce bone formation and strength. Endocrinology. 2004; 145(4):1835–1841.
- Maes C, Carmeliet P, Moermans K, Stockmans I, Smets N, Collen D, et al. Impaired angiogenesis and endochondral bone formation in mice lacking the vascular endothelial growth factor isoforms VEGF164 and VEGF188. Mech Dev. 2002; 111(1-2):61–73.
- Weinstein RS, Jia D, Powers CC, Stewart SA, Jilka RL, Parfitt AM, Manolagas SC. The skeletal effects of glucocorticoid excess override those of orchidectomy in mice. Endocrinology. 2004; 145(4):1980– 1987.







