2Deparment of Faculty of Food Technology, Ho Chi Minh City University of Food Industry (HUFI), 140 Le Trong Tan, Tan Phu district, Ho Chi Minh City,Vietnam
3Department of Bionano Technology, Gachon Medical Research Institute,Gachon University, Seongnam, South Korea
4Vietnam Sports Hospital, Ministry of Culture, Sports and Tourism, Do Xuan Hop Road, My Dinh I Ward, Nam Tu Liem District, Hanoi City, Vietnam #Authors contributed equally to this article
Keywords: Foodborne pathogens; Multiplex-PCR; Five genes; Detection; Simultaneous
Illnesses resulting from the consumption of foods contaminated with pathogens and/ or their toxins have a wide range of economic and public health impact worldwide [25]. The current gold-standard method for detecting foodborne pathogen in food encompasses enrichment with subsequent plating on selective media, biochemical reactions, and serological tests, which are time-consuming and labor-intensive [26]. Currently,, the official procedure for detection of pathogenic bacteria also used to a cultural method, and this procedure could take from 3 to 5 days for confirmation, which is a disadvantage when the results are needed promptly [27,28]. Hence, faster technologies have been applied to develop rapid and enhance sensitive analytical protocol for the foodborne pathogens. The polymerase chain reaction (PCR) is still the most commonly used for detection of the targets bacterial, which based on the identification of the target gene of specific bacteria present after the exponential application with the high sensitivity and specificity. It has become an important tool for detecting and identifying pathogenic organisms in various foods [29- 33]. Consequently, since multiplex PCR assay has been able to simultaneously amplify multiple gene targets by using several sets of target specific or degenerated primers in a single tube [34], it has greatly improved the sensitivity, specificity, and speed of detecting pathogenic organisms [35]. Furthermore, multiplex PCR assay, in comparison with uniplex PCR assays, could save considerable time and workload, and improve efficiency [26,30,31-36].
In this study, we developed a multiplex PCR assay for the rapid and simultaneous detection of five epidemic foodborne pathogens, namely Escherichia coli O157:H7, Staphylococcus aureus, Salmonella spp, Listeria monocytogenes, and Vibrio cholera. The performance of the multiplex assay, including its sensitivity, specificity, and precision in quantitative analyses, was comprehensively evaluated in comparison with the traditional methods. The capacity of the proposed assay to detect multiple target pathogens simultaneously was also tested, and the effect of non-target interference on the assay performance was evaluated. The results obtained with artificially contaminated food samples and real samples demonstrate that the multiplex PCR assay can simultaneously detect these five target foodborne pathogens in foods with high sensitivity and reliability.
No |
Bacteria |
Serovar |
Source |
The target strains |
|||
1 |
E. coli |
O157:H7 |
NIHE |
2 |
E. coli |
O157:H7 |
HCMUS |
3 |
E. coli |
O157:H7 |
NLU |
4 |
S. aureus |
|
ATCC6538 |
5 |
Salmonella enterica |
|
ATCC14028 |
6 |
L. monocytogenes |
|
ATCC15313 |
7 |
V. cholerae |
|
ATCC17802 |
The non-target strains |
|||
1 |
E. coli |
|
ATCC 11775 |
2 |
E. coli |
|
ATCC 25922 |
3 |
E. coli(I1) |
|
Clinical isolate |
4 |
E. coli(I2) |
|
Clinical isolate |
5 |
E. coli(I3) |
|
Chicken isolate |
6 |
E. coli(I4) |
|
Beef isolate |
7 |
E. coli(I5) |
|
Salad isolate |
8 |
Clostridium perfringens |
|
ATCC13124 |
9 |
Bacillus cereus |
|
ATCC11778 |
10 |
Shigella sonnei |
|
ATCC 9290 |
NIHE: National Institute Of Hygiene And Epidemiology;
HCMUS: HCM University of Science; NLU: Nong Lam University
The 16S rRNA gene was also targeted as an internal control of the presence of amplifiable bacterial DNA. The single PCR was performed a total volume of 50 μl using the Veriti96-Well Thermal Cycler (Applied Biosystems, Foster City, CA)in reaction mixtures (Promega) containing 0.5 μM each primer, 200 μM each dNTP, 3 mM MgCl2, 1.5 U Taq DNA polymerase, 1x PCR
Organisms |
Forward primers |
Reverse primer |
Target gene /primer |
Amplicon size (bp) |
Reference |
Staphylococcus aureus |
AATTACATAAAGAACCTGCGACT |
GCACTTGCTTCAGGACCATATT |
|
112 |
This study |
Escherichia coli |
GAGCGAAATAATTTATATGTG |
TGATGATGGCAATTCAGTAT |
stx |
518 |
[28] |
Salmonella spp. |
ACAGTGCTCGTTTACGACCTGAAT |
AGACGACTGGTACTGATCGATAAT |
invA |
244 |
[40] |
Listeria |
GGGCTTTATCCATAAAATA |
TTGGAAGAACCTTGATTA |
iap |
453 |
[41] |
Vibrio cholerae |
CTCAGACGGGATTTGTTAGGCACG |
TCTATCTCTGTAGCCCCTATTACG |
ctxA |
301 |
[42] |
Bacterial DNA |
AGAGTTTGATCATGG CTCAGG |
GGACTACCAGGGTATCTAATT |
16S rRNA |
720 |
This study |
The PCR program was carried out at 95°C for 5 min, followed denaturing by 35 cycles of 94°C for 1 min, 57. 5°C for 1 min, and 72°C for 1 min, and a final 5 min of 72°C for extension. PCR products were electrophoresed in 1% agarose at 100 V for 50 min followed by staining with ethidium bromide (0.5 g/ mL) then visualized under ultraviolet light, and the results were recorded by photography using an ultraviolet trans illuminator (Gel Doc XR system, Bio-Rad).
Strain |
Source |
Genes/ Primers |
|||||
stx |
nuc |
invA |
iap |
ctxA |
16S rRNA |
||
E. coli O157:H7 |
NIHE |
+ |
- |
- |
- |
- |
+ |
E. coli O157:H7 |
HCMUS |
+ |
- |
- |
- |
- |
+ |
E. coli O157:H7 |
NLU |
+ |
- |
- |
- |
- |
+ |
S. aureus |
ATCC6538 |
- |
+ |
- |
- |
- |
+ |
Salmonella spp. |
ATCC14028 |
- |
- |
+ |
- |
- |
+ |
L. monocytogenes |
ATCC15313 |
- |
- |
- |
+ |
- |
+ |
V. cholerae |
ATCC17802 |
- |
- |
- |
- |
+ |
+ |
Species |
Genes |
|||||
nuc |
invA. |
ctxA |
iap |
stx |
16S rRNA |
|
E. coli O157:H7 (NIHE) |
- |
- |
- |
- |
+ |
+ |
E. coli O157:H7 (HCMUS) |
- |
- |
- |
- |
+ |
+ |
E. coli O157:H7 (NLU) |
- |
- |
- |
- |
+ |
+ |
S. aureusATCC6538 |
+ |
- |
- |
- |
- |
+ |
Salmonella entericaATCC14028 |
- |
+ |
- |
- |
- |
+ |
L.monocytogenesATCC15313 |
- |
- |
- |
+ |
- |
+ |
V. choleraATCC17802 |
- |
- |
+ |
- |
- |
+ |
E. coli ATCC 11775 |
- |
- |
- |
- |
- |
+ |
E. coli ATCC 25922 |
- |
- |
- |
- |
- |
+ |
E. coli(I1) |
- |
- |
- |
- |
- |
+ |
E. coli(I2) |
- |
- |
- |
- |
- |
+ |
E. coli(I3) |
- |
- |
- |
- |
- |
+ |
E. coli(I4) |
- |
- |
- |
- |
- |
+ |
E. coli(I5) |
- |
- |
- |
- |
- |
+ |
C. perfringensATCC13124 |
- |
- |
- |
- |
- |
+ |
B. cereusATCC11778 |
- |
- |
- |
- |
- |
+ |
S. sonnei ATCC 9290 |
- |
- |
- |
- |
- |
+ |
Furthermore, in the more recently reported [45] multiplex PCR assays, Lee et al. (2014) reported a multiplex PCR for simultaneous detection of E. coli O157:H7, B. cereus, V. parahaemolyticus, Salmonella spp. L. monocytogenes, and S. aureus in various Korean ready-to-eat foods. The multiplex PCR assay developed by Lee et al. (2007) also allowed for simultaneous detection at concentrations of 100 CFU/ mL of the pathogenic bacteria, after only 24 h of incubation time. The multiplex PCR assay established in this study could similar the incubation time when compared with Lee et al. (2007). It could also detect the five foodborne pathogens with the lowest level of 10 CFU/ mL after 12 h of enrichment. Consequently, a 12-h enrichment period is
Pathogens |
Incubation time (h) |
CFU/ml |
Multiplex PCR results detection in food samples |
||
Vegetables |
Seafood products |
Raw meat fork |
|||
E. coliO157:H7 (stx) |
12 |
0 |
- |
- |
- |
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
18 |
0 |
- |
- |
- |
|
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
24 |
0 |
- |
- |
- |
|
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
S. aureus (nuc) |
12 |
0 |
- |
- |
- |
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
18 |
0 |
- |
- |
- |
|
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
24 |
0 |
- |
- |
- |
|
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
Salmonella spp. (invA) |
12 |
0 |
- |
- |
- |
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
18 |
0 |
- |
- |
- |
|
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
24 |
0 |
- |
- |
- |
|
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
L. monocytogenes (iap) |
12 |
0 |
- |
- |
- |
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
18 |
0 |
- |
- |
- |
|
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
24 |
0 |
- |
- |
- |
|
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
V. cholera (ctxA) |
12 |
0 |
- |
- |
- |
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
0 |
- |
- |
- |
||
18 |
0 |
- |
- |
- |
|
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
24 |
0 |
- |
- |
- |
|
100 |
- |
- |
- |
||
101 |
+ |
+ |
+ |
||
102 |
+ |
+ |
+ |
||
103 |
+ |
+ |
+ |
||
104 |
+ |
+ |
+ |
||
105 |
+ |
+ |
+ |
||
For the final analysis of multiplex PCR assay, we chose five of the representative bacteriaus ually associated with foodborne illnesses: E. coli O157:H7, S. aureus, Salmonella spp, L. monocytogenes and V. cholera . The multiplex PCR method is capable of detecting these five pathogens in approximately 16 hr (12 hr for enrichment, 1 hr for DNA extraction, 2 hr for PCR amplification, 45 min for capillary electrophoretic separation, and 15 min for interpretation). This is, by far, faster than 4 to 7 days to complete for each pathogen using a conventional detection method, which relies primarily on direct plating methods and biochemical tests.
- Chao G,Zhou X,Jiao X,Qian X, Xu L. Prevalence and antimicrobial resistance of foodborne pathogens isolated from food products in China. Foodborne pathogens and disease.(2007);4(3):277–284. doi:10.1089/fpd.2007.0088.
- Law JW,Ab Mutalib NS,Chan KG,Lee LH.Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations. Frontiers in microbiology.(2014);5:770. doi.org/10.3389/fmicb.2014.00770.
- Karmali MA. Infection by Shiga toxin-producing Escherichia coli: an overview. Mol Biotechnol.(2004);26(2):117-22. DOI: 10.1385/MB:26:2:117.
- Coffey B, Rivas L, Duffy G, Coffey A, Ross RP, McAuliffe, O. Assessment of Escherichia coli O157:H7-specific bacteriophages e11/2 and e4/1c in model broth and hide environments. Int J Food Microbiol. (2011):147(3):188-94. doi.org/10.1016/j.ijfoodmicro.2011.04.001.
- Melton-Celsa A, Mohawk K, Teel L, O'Brien A. Pathogenesis of Shiga-toxin producing Escherichia coli. Curr Top Microbiol Immunol. (2012):357:67-103. doi.org/10.1007/82_2011_176.
- Gobius KS, Higgs GM, Desmarchelier PM. Presence of activatable Shiga toxin genotype (stx(2d)) in Shiga toxigenic Escherichia coli from livestock sources. J Clin Microbiol. (2003):41(8):3777-83. doi.org/10.1128/JCM.41.8.3777-3783.2003.
- Baron F, Cochet MF, Pellerin JL, Ben Zakour N, Lebon A, Navarro A, Proudy I, et al. Development of a PCR test to differentiate between Staphylococcus aureus and Staphylococcus intermedius. J Food Prot. 2004;67(10):2302-5.
- Brakstad OG, Maeland JA. Generation and characterization of monoclonal antibodies against Staphylococcus aureus. APMIS. 1989;97(2):166-74.
- B M Madison, V S Baselski. Rapid identification ofStaphylococcus aureus in blood cultures by thermo nuclease testing.J Clin Microbiol. 1983;18(3): 722–724.
- Becker K, von Eiff C, Keller B, Brück M, Etienne J, Peters G. Thermo nuclease gene as a target for specific identification of Staphylococcus intermedius isolates: Use of a PCR-DNA enzyme immunoassay. Diagn Microbiol Infect Dis. 2005;51(4):237-44.doi.org/10.1016/j.diagmicrobio.2004.11.010.
- Wladimir Padilha da Silva; Jorge Adolfo Silva; Márcia Raquel Pegoraro de Macedo; Márcia Ribeiro de Araújo; Márcia Magalhães Mata, et al. Identification of Staphylococcus aureus, S. intermedius, and S. hyicus by PCR amplification ofcoaandnucgenes. Brazilian Journal of Microbiology. (2003);34:125-127. doi.org/10.1590/S1517-83822003000500043.
- Crump JA, Mintz ED. Global trends in typhoid and paratyphoid Fever.Clin Infect Dis. 2010;50(2):241-6. doi: 10.1086/649541.
- Seonghan Kim, Jonathan G. Frye, Jinxin Hu, Paula J. Fedorka-Cray, Romesh Gautom, David S. Boyle. Multiplex PCR-based method for identification of common clinical serotypes of Salmonella enterica subsp. enterica. J Clin Microbiol. 2006; 44(10): 3608–3615. doi: 10.1128/JCM.00701-06.
- Galan, JE, Pace J, Hayman MJ. Involvement of the epidermal growth factor receptor in the invasion of cultured mammalian cells by Salmonella typhimurium.Nature. 1992;357:588–589. doi.org/10.1038/357588a0.
- Galan, J..E., R. Curtiss. Distribution of the invA, -B, -C, and -D genes of Salmonella Typhimurium among other Salmonella serovars: invA mutants of Salmonella Typhi are deficient for entry into mammalian cells. Infection and Immunity.(1991):59:2901–2908.
- Chen S, Wang F, Beaulieu JC, Stein RE, Ge B. Rapid detection of viable Salmonellae in produce by coupling propidium monoazide with loop-mediated isothermal amplification Appl Environ Microbiol. 2011;77(12):4008-16. doi: 10.1128/AEM.00354-11.
- Krascsenicsová K, Piknová L, Kaclíková E, Kuchta T. Detection of Salmonella enterica in food using two-step enrichment and real-time polymerase chain reaction. Lett Appl Microbiol. 2008;46(4):483-7. doi: 10.1111/j.1472-765X.2008.02342.x.
- Wang L, Shi L, Alam MJ, Geng Y, Li L. Specific and rapid detection of foodborne Salmonella by loop-mediated isothermal amplification method.Food Research International. 2008;41(1):69–74. doi.org/10.1016/j.foodres.2007.09.005.
- Modzelewska-Kapituła M, Maj-Sobotka K. The microbial safety of ready-to-eat raw and cooked sausages in Poland: Listeria monocytogenes and Salmonella spp. occurrence. Food Control. 2014;36(1):212–216. doi.org/10.1016/j.foodcont.2013.08.035.
- Ryu J, Park SH, Yeom YS, Shrivastav A, Lee SH, Kim YR, et al. Simultaneous detection of Listeria species isolated from meat processed foods using multiplex PCR. Food Control. 2013;32(2):659–664. doi.org/10.1016/j.foodcont.2013.01.048.
- Cabanes D, Dehoux P, Dussurget O, Frangeul L, Cossart P. Surface proteins and the pathogenic potential of Listeria monocytogenes. Trends Microbiol. 2002;10(5):238-45.
- Farber JM, Peterkin PI. Listeria monocytogenes, a food-borne pathogen. Microbiol Rev. 1991;55(3):476-511.
- Todd ECD, Notermans S. Surveillance of listeriosis and its causative pathogen, Listeria monocytogens. Food control. 2011;22(9):1484-1490. doi.org/10.1016/j.foodcont.2010.07.021.
- Pina M. Fratamico, Arun K. Bhunia, James L. Smith (Eds.). Foodborne Pathogens: Microbiology and Molecular Biology. Emerg Infect Dis. 2006;12(12): 2003. doi: 10.3201/eid1212.061077.
- Motarjemi Y, Käferstein F. Food safety, Hazard Analysis and Critical Control Point and the increase in foodborne diseases: a paradox? Food Control. 1999;10(4-5):325–333. doi.org/10.1016/S0956-7135(99)00008-0.
- Kim JS, Lee GG, Park JS, Jung YH, Kwak HS, Kim SB, et al. A novel multiplex PCR assay for rapid and simultaneous detection of five pathogenic bacteria: Escherichia coli O157:H7, Salmonella, Staphylococcus aureus, Listeria monocytogenes and Vibrio parahaemolyticus. J Food Prot. 2007;70(7):1656–1662.
- Mortensen JE, Ventrola C, Hanna S, Walter A. Comparison of time-motion analysis of conventional stool culture and the BD MAXTM Enteric Bacterial Panel (EBP). BMC Clinical Pathology. 2015;15:9. doi.org/10.1186/s12907-015-0010-8.
- Yamasaki S, Lin Z, Shirai H, Terai A, Oku Y, Ito H, et al. Typing of verotoxins by DNA colony hybridization with poly- and oligo- nucleotide probes, a bead-enzyme-linked immunosorbent assay, and polymerase chain reaction. Microbiol Immunol. 1996;40(5):345-52.
- Cabrera-Garcı´a ME, Va´zquez-Salinas C, Quin˜ones-Ramı´re, EI. Serologic and molecular characterization of Vibrio parahaemolyticus strains isolated from seawater and fish products of the Gulf of Mexico. Appl Environ Microbiol. 2004; 70(11): 6401–6406. doi: 10.1128/AEM.70.11.6401-6406.2004.
- Jofre´ A, Martin B, Garriga M, Hugas M, Pla M, Rodr´iguezLa´zaro D, et al. Simultaneous detection of Listeria monocytogenes and Salmonella by multiplex PCR in cooked ham. Food Microbiol. 2005;22(1):109–115. doi.org/10.1016/j.fm.2004.04.009.
- Park SH, Kim HJ, Kim JH, Kim TW, Kim HY. Simultaneous detection and identification of Bacillus cereus group bacteria using multiplex PCR. J Microbiol Biotechnol. 2007;17(7):1177– 1182.
- Ramesh A, Padmapriya BP, Chrashekar A, Varadaraj MC. Application of a convenient DNA extraction method and multiplex PCR for direct detection of Staphylococcus aureus and Yersinia enterocolitica in milk samples. Mol Cell Probes. 2002;16(4):307–314.
- Sharma VK, Dean-Nystrom EA, Casey TA. Semi automated flurogenic PCR assay (TaqMan) for rapid detection of Escherichia coli O157:H7 and other Shiga toxigenic E. coli. Mol Cell Probes. 1999;13:291–302.
- Fratamico PM, Bagi LK, Pepe T. A multiplex PCR for rapid detection and identification of Escherichia coli O157:H7 in foods and bovine feces. J Food Prot. 2000;63(8):1032-7.
- Xu YG, Cui LC, Tian CY, Li SL, Cao JJ, Liu ZM, Zhang GC. A multiplex polymerase chain reaction coupled with highperformance liquid chromatography assay for simultaneous detection of six foodborne pathogens. Food Control. (2012);25(2):778–783. doi.org/10.1016/j.foodcont.2011.12.014.
- Germini A, Masola A, Carnevali P, Marchelli R. Simultaneous detection of Escherichia coli O157:H7, Salmonella spp., and Listeria monocytogenes by multiplex PCR. Food Control. (2009);20(8):733–738. doi.org/10.1016/j.foodcont.2008.09.010.
- Vo Van Giau, Thuy Trang Nguyen, Thi Kim Oanh Nguyen, Thi Thuy Hang Le, Tien Dung Nguyen. A novel multiplex PCR method for the detection of virulence-associated genes of Escherichia coli O157:H7 in food. 3 Biotech. (2016);6(1):5. doi: 10.1007/s13205-015-0319-0.
- Nguyen TT, Van Giau V, Vo TK. Multiplex PCR for simultaneous identification of E. coli O157:H7, Salmonella spp. and L. monocytogenes in food. 3 Biotech. 2016; 6(2): 205. doi: 10.1007/s13205-016-0523-6.
- Kobayashi H, Kubota J, Fujihara K, Honjoh K, Ilo M, Fujiki N, et al. Simultaneous enrichment of Salmonella spp, Escherichia coli O157:H7, Vibrio parahaemolyticus, Staphylococcus aureus, Bacillus cereus and Listeria monocytogenes by single broth and screening of the pathogens by multiplex real-time PCR. Food Sci Technol Res. 2009;15:427–438. doi.org/10.3136/fstr.15.427.
- C H Chiu, J T Ou. Rapid Identification of Salmonella Serovars in Feces by Specific Detection of Virulence Genes, invA and spvC, by an Enrichment Broth Culture-Multiplex PCR Combination Assay. J Clin Microbiol. 1996 Oct; 34(10): 2619–2622.
- Manzano M, Cocolin L, Ferroni P, Cantoni C, Comi G. A simple and fast protocol to detect PCR Listeria monocytogenes from Meat. J Sci Food Agric. 1997;74(1):25-30.
- H Shirai, M Nishibuchi, T Ramamurthy, S K Bhattacharya, S C Pal, Y Takeda. Polymerase chain reaction for detection of the cholera toxin operon of Vibrio cholera. J. Clin. Microbiol. 1991;29(11):2517-2521.
- Kalendar R, Lee D, Schulman AH. FastPCR software for PCR primer and probe design and repeat search. Genes Genom Genomics. (2009);3:1–14.
- Anonymous. Microbiology of food and animal feeding stuffs-protocol for the validation of alternative methods (EN ISO 16140). European Committee for Standardization, Paris, France(2002).
- Lee N, Kwon KY, Oh SK, Chang HJ, Chun HS, Choi SW. A multiplex PCR assay for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in Korean ready-to-eat food. Foodborne Pathog Dis. 2014;11(7):574-80. doi: 10.1089/fpd.2013.1638.





