2Women and Children’s hospital of Hubei province, Wuhan China
3Department of Clinical laboratory, Shiyan People’s Hospital, Affiliated to Hubei Medical College, Shiyan China
Research proved that cause of ASD may reside in abnormalities at the synapse [8,9]. The SHANK3 gene, encodes a synaptic scaffolding protein [10]. In human beings, SHANK3 is expressed preferentially in cerebral cortex and cerebellum [11,12]. With its multiple protein interaction domains, this molecule directly or indirectly connects with neurotransmitter receptors and cytoskeleton proteins [13,14]. It also participates in the formation, maturation and enlargement of dendritic spines and is essential for the formation of functional synapse [10,15,16]. More importantly, a number of studies have been performed on SHANK3 polymorphisms with autism risk in different populations. However, the results were still controversial. Only one study of polymorphisms in SHANK3 found significant difference between ASD cases and controls [17], while the others were negative [18,19,20].
The genetic variations of SHANK3 of ASD in Chinese Han population has been reported by Qin and Shao, however, it’s not sufficient to demonstrate the co-relation between SHANK3 gene with other SNPs for the lack of diversity of the investigated SNPs. Therefore, further research about the co-relation between genetic variations of SHANK3 with ASD in Chinese Han populations is necessary and important. So far 21586 SNPs (according to NCBI) of SHANK3 gene has been reported. Accordingly, we selected 11 tag SNPs of SHANK3 gene in 100 cases and 100 controls to ascertain the association between this SNP and ASD susceptibility in Chinese Han children to gain a better understanding of the way it exerts its effect on ASD.
SNP |
Position1 |
Minor allele |
Major allele |
MAF2 |
rs2301584 |
51171497 |
A |
G |
0.223 |
rs2341011 |
51139635 |
T |
C |
0.321 |
rs41281537 |
51171667 |
A |
G |
0.058 |
rs5770820 |
51150473 |
A |
G |
0.253 |
rs5770992 |
51146139 |
G |
A |
0.108 |
rs6010061 |
51151724 |
C |
T |
0.417 |
rs6010065 |
51158017 |
C |
G |
0.49 |
rs756638 |
51171693 |
A |
G |
0.299 |
rs8137951 |
51165664 |
A |
G |
0.374 |
rs9616816 |
51123505 |
A |
G |
0.362 |
rs9616915 |
51117580 |
C |
T |
0.358 |
2 MAF, minor allele frequency
SNP |
Primers (5’→3’) |
product length (bp) |
Tm (℃) |
|
rs9616816 |
Forward |
GCTCTCAGCATGGAAAGA |
57 |
54.2 |
TCCCATCACTGTTGTTTT |
|
|
||
rs6010061 |
Forward |
GGAGTTTTCTCTCCATTCATATCTT |
60 |
55 |
CTTAAGCACCATACTCC |
|
|
||
rs756638 |
Forward |
TGTGTCTGTCCCTCATACC |
102 |
54.5 |
CATGTGGTCCAGGCTGA |
|
|
||
rs6010065 |
Forward |
TGGTACTTCTGCGTCGG |
89 |
59 |
GCCAGTACAGGGCTCC |
|
|
||
rs2301584 |
Forward |
GTTCCGCTTCACCTCCTT |
69 |
57 |
GCCTCAGGACTGGAGCA |
|
|
||
rs41281537 |
Forward |
GCTCAGTTGCCTGCTTG |
86 |
58 |
CCGGTATGAGGGACAGA |
|
|
||
rs2341011 |
Forward |
TCCGCTTCACCTCCTTT |
67 |
56.8 |
GCCTCAGGACTGGAGCA |
|
|
||
rs5770992 |
Forward |
TGGTCAGAATTTTCAC |
50 |
45 |
TTATCTACATGGGGTT |
|
|
||
rs5770820 |
Forward |
CTCTAGGGAGCAGGGAGAC |
112 |
55 |
GACCAGCAGAAAGAAGCAA |
|
|
||
rs9616915 |
Forward |
TCTCCACGACCACGC |
52 |
63 |
CTCCTGCCAGCCATT |
|
|||
rs8137951 |
Forward |
ATGTCATACATACTATTTTTGCATT |
55 |
53.6 |
TAGCACAAAGCCAGGAA |
|
|
SNP |
genotype |
Control |
Case |
Allele OR(95% CI), |
Additive OR(95% CI), |
Dominant OR(95% CI), |
Recessive OR(95% CI),
|
Rs9616816 |
GG |
31 |
19 |
|
|||
GA |
45 |
37 |
|
||||
AA |
24 |
44 |
1.918 (1.287-2.858), 0.001 |
1.791 (1.217-2.635), 0.003 |
1.927(0.994-3.737), 0.052 |
2.569(1.382-4.774), 0.003 |
|
rs6010061 |
TT |
69 |
82 |
|
|||
CT |
25 |
15 |
|
||||
|
6 |
3 |
0.517 (0.291-0.919),0.023 |
0.550 (0.320-0.946), 0.031 |
0.472 (0.242-0.922), 0.028 |
0.436 (0.104-1.818), 0.254 |
|
rs756638 |
GG |
61 |
77 |
|
|||
GA |
34 |
21 |
|
||||
AA |
5 |
2 |
0.506 (0.296-0.866),0.012 |
0.510 (0.296-0.878), 0.015 |
0.461 (0.248-0.858), 0.014 |
0.386 (0.072-2.064), 0.266 |
|
rs6010065 |
GG |
28 |
37 |
|
|||
GC |
43 |
39 |
|
||||
CC |
29 |
24 |
0.755 (0.509-1.119), 0.161 |
0.788 (0.543-1.142), 0.208 |
0.674 (0.368-1.233), 0.200 |
0.764 (0.403-1.452), 0.412 |
|
rs2301584 |
GG |
70 |
71 |
|
|||
GA |
26 |
27 |
|
||||
AA |
4 |
2 |
0.896 (0.526-1.524), 0.684 |
0.920 (0.542-1.562), 0.759 |
0.992 (0.536-1.834), 0.979 |
0.468 (0.083-2.637), 0.389 |
|
rs41281537 |
GG |
79 |
73 |
|
|||
GA |
18 |
26 |
|
||||
AA |
3 |
1 |
1.194 (0.666-2.141), 0.552 |
1.157 (0.647-2.068), 0.623 |
1.355 (0.703-2.612), 0.365 |
0.304 (0.031-3.002), 0.308 |
|
rs2341011 |
CC |
49 |
40 |
|
|||
CT |
41 |
47 |
|
||||
TT |
10 |
13 |
1.310 (0.864-1.987), 0.204 |
1.309 (0.861-1.988), 0.208 |
1.457 (0.829-2.560), 0.191 |
1.325 (0.548-3.205), 0.532 |
|
rs5770992 |
AA |
60 |
65 |
|
|||
AG |
32 |
28 |
|
||||
GG |
8 |
7 |
1.189 (0.769-1.838), 0.437 |
0.859 (0.552-1.338), 0.502 |
0.805 (0.453-1.433), 0.462 |
0.871 (0.302-2.512), 0.799 |
|
rs5770820 |
GG |
23 |
33 |
|
|||
GA |
44 |
34 |
|
||||
AA |
33 |
33 |
0.818 (0.552-1.212), 0.317 |
0.829 (0.578-1.188), 0.307 |
0.568 (0.301-1.073), 0.082 |
0.991 (0.548-1.791), 0.975 |
|
rs9616915 |
TT |
87 |
87 |
|
|||
CT |
12 |
11 |
|
||||
CC |
1 |
2 |
1.077 (0.506-2.295), 0.847 |
1.027 (0.501-2.104), 0.942 |
0.940 (0.407-2.169), 0.885 |
2.174 (0.187-25.238), 0.535 |
|
rs8137951 |
GG |
55 |
58 |
|
|||
GA |
36 |
32 |
|
||||
AA |
9 |
10 |
0.950 (0.609-1.481), 0.821 |
0.955 (0.627-1.453), 0.828 |
0.886 (0.505-1.554), 0.672 |
1.116 (0.430-2.895), 0.822 |
2 P values derived from logistic regression after adjustment for gender and age of genotype distribution
Haplotypes |
Cases (Freq.) |
Controls (Freq.) |
χ2 |
P |
Odds ratio (95%CI) |
A C A |
2.90(0.015) |
2.70(0.013)) |
/ |
/ |
/ |
A C G* |
12.17(0.061) |
16.97(0.085) |
0.875 |
0.35 |
0.695 [0.324~1.494] |
A T A* |
12.52(0.063) |
20.88(0.104) |
2.326 |
0.13 |
0.570 [0.274~1.183] |
A T G* |
97.41(0.487) |
52.45(0.262) |
21.676 |
3.30E-06 |
2.702 [1.769~4.126] |
G C A |
2.47(0.012) |
3.43(0.017) |
/ |
/ |
/ |
G C G* |
3.45(0.017) |
13.90(0.070) |
6.626 |
0.01 |
0.234 [0.071~0.773] |
G T A* |
7.11(0.036) |
17.00(0.085) |
4.365 |
0.04 |
0.395 [0.161~0.970] |
G T G* |
61.96(0.310) |
72.67(0.363) |
1.367 |
0.24 |
0.779 [0.512~1.184] |
Loci chosen for hap-analysis: rs9616816, rs6010061, rs756638.
Since the first report of SHANK3 mutations in ASD was published by Moessner et al. in 2007, several studies have been investigated the relationship between SHANK3 gene polymorphisms and ASD in different populations. Qin found none of the five SNPs was significant evidence (P < 0.05) for preferential transmission of an allele by FBAT in all samples [18]; Sykes’s data suggested that SHANK3 deletions may be limited to lower functioning individuals with autism[19]; Chien’s research revealed that the 5 tag SNPs (rs2341011, rs5770992, rs5770820, rs6010065,and rs2301584) were not significant statistically [19 ]. However, there were few positive results of association between SHANK3 polymorphisms and ASD. Shao’s study of rs9616915 polymorphisms in SHANK3 found significant difference between ASD cases and controls in Chinese Han population [17], while the others reported that SHANK3 might not represent a major susceptibility gene for ASD. The inconsistency with these pioneer works is possibly due to the difference of the sample size, individual genetic background, research design and environmental factors. However, the results were not fully consistent with previous reports. In the present study, we found the rs9616816, rs756638 and rs6010061 polymorphisms in the SHANK3 gene has a statistically significant association with ASD susceptibility and may affect the subject susceptibility toward autism in the Chinese Han population. We established genotyping methods of 11 SNPs in the SHANK3 gene cluster by high-resolution melting and successfully found both the rs9616816 and rs6010061 were associated with ASD risk. The protective role of rs9616816 A allele against the risk of ASD suggested SHANK3 a possible candidate gene involved in the pathogenesis of ASD. Furthermore, Analysed with three models for genotype distributions, the association between SHANK3 SNPs (rs9616816, rs756638, rs6010061) and ASD remained significant after performing statistical adjustments for age and sex. This result supported previous reports that SHANK3 gene is a susceptible predictor of ASD risk factors [21,22,23,24,25].
Till now, little information is known about the role of SHANK3 gene in the diverse pathological processes to ASD children. SHANK3 gene, encodes a protein of the postsynaptic density of excitatory synapses, had been shown to bind to neuroligin, which, form a complex at glutamatergic synapses. In humans, SHANK3 was found expressed predominantly in cerebral cortex and cerebellum [4,12, 26]. Durand and coworkers then identified two alterations in SHANK3 in subjects with an ASD, one is a de novo insertion of a G nucleotide in exon 21 of SHANK3, which leads to a frame-shift and presumed loss of function; the other was found in an unrelated family with a de novo deletion of terminal 22q13, with the breakpoint in intron 8 of SHANK3 [27]. Genetic and functional data implicate SHANK3 as a potential genic cause of ASD, which lead us to seek to further assess the involved polymorphisms and associated phenotypic outcomes. Recent studies indicate that autism is a disease of polygenic inheritance. Analysis of polymorphisms in the SHANK3 gene allows to effectively screen for autism risk [17]. Most previously reported studies narrowed on the mutations region. In our study, we covered the whole region of the SHANK3 gene, 11 tag SNPs, spreading in coding regions, 5′- and 3′- UTR regions, were selected and studied in our cohort. Positive SNPs, found only in intron (rs9616816 and rs6010061) and 3′ untranslated region (3′ UTR) (rs756638) of SHANK3 gene, indicated potential mechanism on the affection of the expression of SHANK3 by binding with transcription factors or micro RNA, could be altering the interaction of Shank with miRNAs.
The correlation between genotype and phenotype is very complicated, both genetic and environmental infaectors have significant effect on ASD. The further investigation is that positive SNPs how to regulate the expression of SHANK3 gene by micRNA to reveal the role SHANK3 gene on the pathogenesis of ASD.
- Abrahams BS, Geschwind DH. Advances in autism genetics:on the threshold of a new neurobiology. Nat Rev Genet. 2008;9(5):341-55. doi: 10.1038/nrg2346
- H A. Die. Autistischen Psychopathen” im Kindesalter. European Archives of Psychiatry and Clinical Neuroscience. 1944; 117: 76-136.
- Lamb JA, Moore J, Bailey A, Monaco AP. Autism: recent molecular genetic advances. Hum Mol Genet. 2000;9(6):861-868.
- Baron MK, Boeckers TM, Vaida B, Faham S, Gingery M, Sawaya MR. An architectural framework that may lie at the core of the postsynaptic density. Science. 2006;311(5760):531-535. doi: 10.1126/science.1118995
- Veenstra-VanderWeele J, Cook EH Jr. Molecular genetics of autism spectrum disorder. Mol Psychiatry. 2004;9(9): 819-832. doi: 10.1038/sj.mp.4001505
- Roberts JL, Hovanes K, Dasouki M, Manzardo AM, Butler MG. Chromosomal microarray analysis of consecutive individuals with autism spectrum disorders or learning disability presenting for genetic services. Gene. 2014; 535(1):70-8. doi: 10.1016/j.gene.2013.10.020
- Newschaffer CJ, Curran LK. Autism: an emerging public health problem. Public Health Rep. 2003; 118(5):393-399. doi:10.1093/phr/118.5.393
- Garber K. Neuroscience. Autism's cause may reside in abnormalities at the synapse. Science. 2007;317(5835):190-191. doi: 10.1126/science.317.5835.190
- O'Conno rEC, Bariselli S, Bellone C. Synaptic basis of social dysfunction: a focus on postsynaptic proteins linking group-I mGluRs with AMPARs and NMDARs. Eur J Neurosci. 2014;39(7), 1114-1129. doi: 10.1111/ejn.12510
- Tu JC, Xiao B, Naisbitt S, Yuan JP, Petralia RS, Brakeman P. Coupling of mGluR/Homer and PSD-95 complexes by the Shank family of postsynaptic density proteins. Neuron. 1999;23(3):583-592.
- Lim S, Naisbitt S, Yoon J, Hwang JI, Suh PG, Sheng M, et al. Characterization of the Shank family of synaptic proteins. Multiple genes, alternative splicing, and differential expression in brain and development. J Biol Chem. 1999;274(41):29510-29518.
- Bonaglia MC, Giorda R, Borgatti R, Felisari G, Gagliardi C, Selicorni A. Disruption of the ProSAP2 gene in a t(12;22)(q24.1;q13.3) is associated with the 22q13.3 deletion syndrome. Am J Hum Genet. 2001;69(2):261-268. doi:10.1086/321293
- Ehlers MD. Synapse structure: glutamate receptors connected by the shanks. Curr Biol. 1999;9(22), R848-850.
- Boeckers TM, Bockmann J, Kreutz MR, Gundelfinger ED. ProSAP/Shank proteins - a family of higher order organizing molecules of the postsynaptic density with an emerging role in human neurological disease. J Neurochem. 2002;81(5):903-910.
- Roussignol G, Ango F, Romorini S, Tu JC, Sala C, Worley PF, et al. Shank expression is sufficient to induce functional dendritic spine synapses in aspiny neurons. J Neurosci. 2005;25(14):3560-3570.doi: 10.1523/JNEUROSCI.4354-04.2005
- Durand CM, Betancur C, Boeckers TM, Bockmann J, Chaste P, Fauchereau F, et al. Mutations in the gene encoding the synaptic scaffolding protein SHANK3 are associated with autism spectrum disorders. Nat Genet. 2007;39(1):25-27. doi: 10.1038/ng1933
- Shao S, Xu S, Yang J, Zhang T, He Z, Sun Z,et al. A commonly carried genetic variant, rs9616915, in SHANK3 gene is associated with a reduced risk of autism spectrum disorder: replication in a Chinese population. Mol Biol Rep. 2014;41(3): 1591-1595. doi: 10.1007/s11033-013-3005-5
- Qin J, Jia M, Wang L, Lu T, Ruan Y, Liu z. Association study of SHANK3 gene polymorphisms with autism in Chinese Han population. BMC Med Genet. 2009;10: 61. doi: 10.1186/1471-2350-10-61
- Sykes NH, Toma C, Wilson N, Volpi EV, Sousa I, Pagnamenta AT. Copy number variation and association analysis of SHANK3 as a candidate gene for autism in the IMGSAC collection. Eur J Hum Genet. 2009;17(10): 1347-1353. doi:10.1038/ejhg.2009.47
- Chien YL, Wu YY, ChiuYN, Liu SK, Tsai WC, Lin PI, et al. Association study of the CNS patterning genes and autism in Han Chinese in Taiwan. Prog Neuropsychopharmacol Biol Psychiatry. 2011;35(6):1512-1517. doi: 10.1016/j.pnpbp.2011.04.010
- Gauthier J, Spiegelman D, Piton A, Lafreniere RG, Laurent S, St-Onge J. Novel de novo SHANK3 mutation in autistic patients. Am J Med Genet B Neuropsychiatr Genet. 2009;150B(3):421-424. doi: 10.1002/ajmg.b.30822
- Kolevzon A, Cai G, Soorya L, Takahashi N, Grodberg D, Kajiwara Y. Analysis of a purported SHANK3 mutation in a boy with autism: clinical impact of rare variant research in neurodevelopmental disabilities. Brain Res. 2011;1380:98-105. doi: 10.1016/j.brainres.2010.11.005
- Soorya, Kolevzon A, Zweifach J, Lim T, Dobry Y, Schwartz L. Prospective investigation of autism and genotype-phenotype correlations in 22q13 deletion syndrome and SHANK3 deficiency. Mol Autism. 2013; 4(1):18. doi: 10.1186/2040-2392-4-18
- Uchino S, Waga C. SHANK3 as an autism spectrum disorder-associated gene. Brain Dev. 2013; 35(2):106-10. doi:10.1016/j.braindev.2012.05.013
- Leblond CS, Nava C, Polge A, Gauthier J, Huguet G, Lumbroso S, et al. Meta-analysis of SHANK Mutations in Autism Spectrum Disorders: a gradient of severity in cognitive impairments. PLoS Genet. 2014;10(9):e1004580. doi: 10.1371/journal.pgen.1004580
- Meyer G, Varoqueaux F, Neeb A, Oschlies M, Brose N. The complexity of PDZ domain-mediated interactions at glutamatergic synapses: a case study on neuroligin. Neuropharmacology. 2004; 47(5), 724-733. doi: 10.1016/j.neuropharm.2004.06.023
- Durand CM, Perroy J, Loll F, Perrais D, Fagni L, Bourgeron T, et al. SHANK3 mutations identified in autism lead to modification of dendritic spine morphology via an actin-dependent mechanism. Mol Psychiatry. 2012;17(1):71-84. doi: 10.1038/mp.2011.57
- Veenstra-VanderWeele J, Cook EH Jr. Molecular genetics of autism spectrum disorder. Mol Psychiatry. 2004;9(9): 819-832. doi: 10.1038/sj.mp.4001505



