Research Article
Open Access
Biochemical and molecular characterization of cellulase
producing bacterial isolates from cattle dung samples
Preeti Vyas and Ashwani Kumar*
Metagenomics and Secretomics Research Laboratory, Department of Botany, Dr. Harisingh Gour University (A Central University),
Sagar-470003, (M.P.), India
*Corresponding author: Ashwani Kumar, Assistant Professor, Metagenomics and Secretomics Research Laboratory, Department of Botany, Dr. Harisingh Gour University (A Central University), Sagar-470003, (M.P.), India, Tel: 91-7697432012, E-mail:
@
Received: July 20, 2018; Accepted: July 24, 2018; Published: July 27, 2018
Citation: Preeti Vyas, Ashwani Kumar (2018) Biochemical and molecular characterization of cellulase producing bacterial isolates from cattle dung samples. J Adv Res Biotech 3(1):1-6. DOI: http://dx.doi.org/10.15226/2475-4714/3/1/00132
Abstract
Recently production of bio fuel and other platform chemicals
from lignocellulosic biomass is gaining constant attention to meet the
demand of energy all over the Globe. Utilizing agricultural residues
for bio ethanol generation using novel bacterial isolates will provide
a solution for energy problem. This study has been conducted with
the following objectives; i) to search the novel bacterial isolates that
can efficiently degrade the cellulose and ii) their biochemical and
molecular characterization by using 16S rRNA sequencing. Almost, 15
bacteria’s have been isolated from cattle dung out of which 10 isolates
showed cellulase activity on CMC (carboxymethyl cellulose) screening
media. These bacterial isolates with high cellulase activity were
further characterized on the basis of gram staining, morphology and
also by various biochemical utilization tests (Citrate, lysine, ornithine,
urease, phenylalanine, H2S production, nitrate reduction, glucose,
lactose, adonitol, sorbitol, arabinose, and 35 different carbohydrate
sources). Results showed that out of three isolates (AKPCD108,
AKPCD109 and AKPBD1), the isolate number AKPBD1 showed
58.33 % utilization of biochemical’s which is followed by AKPCD108
and AKPCD109, respectively. Among all carbohydrates utilized,
AKPBD1 showed 68.57% utilization and other isolates (AKPCD108
& AKPCD109) were at par. These three isolates were molecularly
identified using 16S rDNA sequencing. The obtained sequences
were blast and phylogenetic analysis of their sequences showed
that AKPCD108 has 99% similarity with Pseudomonas otitidis strain
MCC10330, AKPCD109 has 99% similarity with Stenotrophomonas
koreensis strain TR6-01 (Flavobacterium lutescens) and AKPBD1 has
99% similar with Serratia marcescens subsp. sakuensis strain KRED.
In this study, we conclude that, these isolates are highly promising
and have the ability to produce cellulase enzyme and can be used for
efficient biological pretreatment of lignocellulosic biomass following
production of biofuels and bioproducts.
Keywords: Cellulolytic bacteria; Lignocelluloses; 16S rDNA; Biomass; Biofuel
Keywords: Cellulolytic bacteria; Lignocelluloses; 16S rDNA; Biomass; Biofuel
Introduction
Depletion of fossil fuels and worldwide increases of energy
demand and environmental concern has lead in search for
an alternative renewable energy resource like lignocellulosic
biomass [1,2]. Lignocelluloses are renewable, cost efficient,
eco-friendly potential feedstock for the production of bio fuels.
However, the bioconversion of this lignocellulosic biomass
into sugars is not easy due to the cellulose crystallinity, degree
of polymerization, presence of lignin which poses hurdle for
enzymatic hydrolysis. Thus, utilizing different pre-treatment
methods for bioconversion process increases the overall
digestibility of cellulose and hemicelluloses, and therefore
removal of lignin from lignocellulosic biomass. However, among
the pre-treatment, use of chemical pre-treatment is hazardous
for the environment. Therefore, the biological pre-treatment
method on the other hand is environmental friendly and gaining
popularity now a day because this method is less toxic, requires
very low energy input, and much higher sugar yield. The biomass
of the plant is mainly composed of cellulose, hemicelluloses and
lignin, which constitute an important material to be converted
into various type of liquid fuels [3–5].
Present trends to produce cellulosic ethanol has been focused mainly on sorghum, wheat straw, sunflower, maize, sugarcane, and non-edible oil seed plants; however, use of agricultural residues that are not exploited or which could be used more efficiently for ethanol production. The waste material generated from various agricultural fields like stalks, straw, husk, stover, and stems, etc. are highly rich in cellulosic content that had generated great interests to use them as an energy source [6–9]. Among all the component of biomass, cellulose is the principal constituent of the cell wall and mainly composed of units of D-glucose that are linked together to form a linear chain by ß-1,4-glycosidic linkages. Cellulose is generally found as micro fibrils that are “2– 20nm” in diameter and “100–40,000 nm” long in the biomass. The enzyme named cellulase has great potential to degrade cellulose and also convert cellulose into simple sugars. Cellulase mainly composed of three major components namely, cellobiohydrolase, endoglucanase or carboxymethylcellulase (CMCase), and betaglucosidases [10]. Microorganism particularly bacteria and fungi produced this enzyme in nature and exploring different natural resources to isolate bacteria is imperative for higher production of cellulolytic enzymes [11,12].
Although, it is validated fact that proper degradation of lignocellulosic substrates requires a complex set of enzymes such as laccases, exoglucanases, endoglucanases, peroxidases, fucosidases, xylanases and β-glucosidases [13]. Variety of microbes that are present in nature like many bacterial and fungal species secretes different types of lignocellulolytic enzymes which help in degradation of lignocellulosic biomass into simple sugars. These sugars can be further converted into bio fuels and other platform chemicals. The present work was conducted to isolate cellulolytic bacteria from cattle dung and to identify them biochemically and molecularly by using 16S rRNA gene.
Present trends to produce cellulosic ethanol has been focused mainly on sorghum, wheat straw, sunflower, maize, sugarcane, and non-edible oil seed plants; however, use of agricultural residues that are not exploited or which could be used more efficiently for ethanol production. The waste material generated from various agricultural fields like stalks, straw, husk, stover, and stems, etc. are highly rich in cellulosic content that had generated great interests to use them as an energy source [6–9]. Among all the component of biomass, cellulose is the principal constituent of the cell wall and mainly composed of units of D-glucose that are linked together to form a linear chain by ß-1,4-glycosidic linkages. Cellulose is generally found as micro fibrils that are “2– 20nm” in diameter and “100–40,000 nm” long in the biomass. The enzyme named cellulase has great potential to degrade cellulose and also convert cellulose into simple sugars. Cellulase mainly composed of three major components namely, cellobiohydrolase, endoglucanase or carboxymethylcellulase (CMCase), and betaglucosidases [10]. Microorganism particularly bacteria and fungi produced this enzyme in nature and exploring different natural resources to isolate bacteria is imperative for higher production of cellulolytic enzymes [11,12].
Although, it is validated fact that proper degradation of lignocellulosic substrates requires a complex set of enzymes such as laccases, exoglucanases, endoglucanases, peroxidases, fucosidases, xylanases and β-glucosidases [13]. Variety of microbes that are present in nature like many bacterial and fungal species secretes different types of lignocellulolytic enzymes which help in degradation of lignocellulosic biomass into simple sugars. These sugars can be further converted into bio fuels and other platform chemicals. The present work was conducted to isolate cellulolytic bacteria from cattle dung and to identify them biochemically and molecularly by using 16S rRNA gene.
Materials and Methods
Isolation and selection of bacterial isolates for
cellulase activity
Cattle dung samples were collected in sterile plastic bottles
from Sagar, Madhya Pradesh. One gram of dung sample was
used to grow bacteria in Nutrient Agar media (Hi Media, India)
and incubated at 28°C for 48hrs in incubator and maintained at
nutrient broth for further use. Pure culture of bacterial isolates
was maintained in separate plate before testing them on selective
media. Then 0.1 ml of the bacterial suspension was adjusted
to 0.05 cell density by sterile 0.85% NaCl solution. Then these
bacterial inoculums was transferred to Carboxymethyl Cellulose
(CMC) plates for screening CMC activity (Shankar et al., 2011)
and incubated at 37°C for 2 days. These plates were then flooded
with 0.1% Congo red/Gram’s Iodine solution for about 20 min
and then washed by using 1 M NaCl for 15 min. Formation of
the clear halos zones by these bacterial isolates was indicated by
their cellulose degrading activity or cellulase activity [14]
Biochemical characterization of cellulase producing
bacterial isolates
A combination of 12 biochemical tests (HiAssortedTM KB002,
HIMEDIA, INDIA) and 35 tests for utilization of carbohydrates
(HiCarboTM, HIMEDIA, INDIA) were used for biochemical
characterization of cellulase producing bacterial isolates by
following the instruction provided by the manufacturer. Tests
used in this kit are presented in table 1 and table 2. These
tests are based on the principle of color change, change in pH,
and utilization of substrate by bacterial isolates. The bacterial
isolates used for these test were isolated and purified. Only pure
cultures were used and kit was opened aseptically. 50μl of the
prepared inoculums was added to each well by using surface
inoculation method. The kit were also be inoculated by stabbing
each individual well with a loopful of inoculums and incubation
at 35°C temp for 18-24 hours and changes in color were observed
and recorded.
DNA Extraction and molecular identification
Total genomic DNA of bacterial isolates was extracted by
using the Insta Gene TM Matrix Genomic DNA isolation kit.
DNA concentration was determined by nano drop. The isolated
bacterial DNA was further amplified by using universal forward
primer 27F with primer sequence (AGAGTTTGATCMTGGCTCAG)
and reverse primer 1492R with primer sequence
(TACGGTACCTTGTTACGACTT). The PCR mixture contained
1 μL of DNA template, and 20 μL of PCR reaction mixture. The
PCR amplification were performed by using automated thermal
cycler (PTC-200, Biorad, Hercules, CA, USA) with the following
PCR conditions: an initial denaturation at 94°C for about 5 min
followed by 30 cycles of amplification at 94°C for 30 s, annealing
at 52°C for about a min and extension at 72°C for 2 min, final
elongation at 72°C for 10 min. The PCR products were purified
using QIAquick PCR Purification Kit (Qiagen, Hilden, Germany)
according to the manufacturer’s instructions. Selected PCR
products were then sequenced using an ABI Big Dye Terminator
v3.1 cycle sequencing kit (Applied Biosystems, Grand Island, NY,
USA) and these sequences were read on an Applied Biosystems
3130 genetic analyzer (Applied Biosystems). Sequence analysis
was performed using Sequence Scanner v1.0 software. Amplified
PCR products of 16S ribosomal gene were confirmed on 1%
agarose gel, purified using QIAquick PCR purification kit
(QIAGEN)
Bioinformatics protocol
These 16S rDNA sequences were then compared with other
sequences available in Gene Bank databases using the NCBI BLAST
at http://www.ncbi.n1m.nih.gov/blast/Blast.cgi. Sequences were
submitted to NCBI GenBank data base for getting accession
numbers. The phylogenetic analysis of sequences with the closely
related sequence of NCBI blast results was performed by using the
automated NCBI pipeline. A phylogenetic tree for these bacterial
sequences were constructed by using iTOL (Interactive tree of
life) after establishing relationship among the similar sequences
analysis generated from Mega 5.05 software [15,16].
Results and Discussion
The large number of microorganisms from the diverse
environment permits screening for more efficient lignocellulolytic
enzymes to help overcome current challenges in bio fuel
production [4,17–20]. Previous studies reported that cow/
buffalo dung is rich in cellulase producing bacterial isolates
[21]. Therefore, in this study we have tried to isolate good
cellulase producing bacteria from the cow dung collected
from the Dr. Harisingh Gour University Campus, Sagar, Madhya
Pradesh. Almost, 15 bacteria’s have been isolated from cattle
dung out of which 10 isolates showed cellulase activity on CMC
(Carboxymethyl Cellulose) screening media (Figure 1). Cellulase
enzyme activities were seen by the appearance of zones around
the bacterial colonies on the screening media. Out of ten isolates
we selected only three for further characterization; these were
named as AKPCD108, AKPCD109 and AKPBD1. These isolates
were found to be gram negative after gram staining test. These
bacterial isolates with high cellulose activity were tested by gram
staining, morphological ground and also by various biochemical
utilization tests (Citrate, ornithine, lysine, phenylalanine, urease,
H2S production, nitrate reduction, glucose, lactose, adonitol,
arabinose, sorbitol and 35 different carbon sources) (Table 1 & 2).
Figure 1: Bacterial isolates from buffalo dung showing cellulase activity
Table 1: Heat map of Biochemical Utilization by selected bacterial isolates
from cattle dung
Note: (Dark blue colors indicates positive test for the respective source and grey indicates negative test result.)
Note: (Dark blue colors indicates positive test for the respective source and grey indicates negative test result.)
Results showed that among these three isolates (AKPCD108,
AKPCD109 and AKPBD1), the isolate number AKPBD1 showed
58.33 % utilization of biochemical’s (12 different biochemical’s
and one control) which is followed by AKPCD108 and AKPCD109.
Among all carbohydrates (35 different carbon source and one
control) utilized, AKPBD1 showed 68.57% utilization and other
isolates (AKPCD108 & AKPCD109) were at par for the utilization
of these carbohydrates (Table 1 and Table 2).
Among the biochemical (ornithine, nitrate and glucose) were utilized by all isolates and phenylalanine and arabinose have not been used by any isolates. On the other hand dextrose, sodium
Among the biochemical (ornithine, nitrate and glucose) were utilized by all isolates and phenylalanine and arabinose have not been used by any isolates. On the other hand dextrose, sodium
Table 2: Heat map of Carbohydrate utilization tests of selected bacterial
isolates from cattle dung
Note: (Black colors indicates positive test for the respective source and grey indicates negative test result)
Note: (Black colors indicates positive test for the respective source and grey indicates negative test result)
gluconate and inositol were used by all the isolates and lactose,
melezitose, xylitol have not been used by any isolate. Our results
are supported by Khianngam et al. (2014), in which they have
screening and identified cellulase producing bacteria from oil
palm meal. They obtained 8 isolates belongs to Bacillus, and one
to Paenibacillus and Lysinibacillus by using 16S rDNA sequencing.
The obtained sequences were blast and phylogenetic analysis
of their sequences showed that AKPCD108 has 99% similarity
with Pseudomonas otitidis strain MCC10330, AKPCD109 has
99% similarity with Stenotrophomonas koreensis strain TR6-01
(Flavobacterium lutescens) and AKPBD1 has 99% similar with
Serratia marcescens subsp. sakuensis strain KRED (Table 3). The
phylogenetic relationship of these identified cellulase producer
are shown in Figures 2a-c. Among the bacterial isolates most
common cellulase producer are belong to the following genera;
Cellulomonas, Cellvibrio, Clostridium, Paenibacillus, Pseudomonas,
Ruminococcus, B. subtilis, B. cereus, B. altitudinis, Paenibacillus,
Acetivibrio, Bacillus, Sporocytophaga, Bacteroides, Micrococcus
etc [14, 22]. But the isolates screened in this study for cellulase
production were not reported by other workers.
Table 3: Different bacterial isolates from cattle dung identified using 16SrRNA sequencing
S.No. |
Isolate number |
Bacterial strain |
Gram staining reaction |
NCBI GENE BANK NO |
NCBI database match |
Percentage of identity /Accession |
1. |
AKPCD108 |
Pseudomonas otitidis |
Gram negative |
KX698105 |
Pseudomonas otitidis strain MCC10330 |
99%/NR_043289.1 |
2. |
AKPCD109 |
Flavobacterium lutescens |
Gram negative rod |
KX698103 |
Stenotrophomonas koreensis strain TR6-01 |
99%/NR_041019.1 |
3. |
AKPBD1 |
Serratia marcescens |
Gram negative rod |
KX698107 |
Serratia marcescens subsp. sakuensis strain KRED |
99%/NR_036886.1 |
Figure 2(a): AKPCD108
Figure 2(b): AKPCD 109
Figure 2(c): AKPBD1
Figure 2: Phylogenetic tree created by iTOL software to present relationship between closely related species
Figure 2: Phylogenetic tree created by iTOL software to present relationship between closely related species
Conclusion
In conclusion, 10 cellulase producing bacteria were isolated
from cattle dung samples from University Campus, Sagar Madhya
Pradesh, India. They were screened for their cellulase activity by
Congo red test and they showed hydrolysis capacity on plates.
On the basis of their phenotypic characteristics and phylogenetic
analyses, three isolates AKPCD108, AKPCD109 and AKPBD1
were closely related to Pseudomonas, Stenotrophomonas and
Serratia marcescens, respectively. However, the further research
on these isolates would be required utilize their full potential or
to maximise the production of cellulase enzymes and degradation
of agriculture residues. Finally based on the present research it
can be concluded that cattle dung can be a very good source for
the isolation of cellulase producing bacteria and their advance
biotechnological application, mainly for biomass hydrolysis.
Contributory Statements
PV has conducted the experiment. AK proposed the
experiments, prepared and edited the manuscript.
Acknowledgement
PV and AK would like to acknowledge the UGC Start-up grant
(Awarded to AK) for the financial support. Authors would like
to acknowledge Ms. Anamika Dubey (DST Inspire) for valuable
suggestions.
ReferencesTop
- Sharma HK, Xu C, Qin W. Biological Pretreatment of Lignocellulosic Biomass for Biofuels and Bioproducts:An Overview. Waste and Biomass Valorization. 2017;1–17.
- Ahmad S, Pathak V V, Kothari R, Kumar A, Babu S, Krishna N. Optimization of nutrient stress using C pyrenoidosa for lipid and biodiesel production in integration with remediation in dairy industry wastewater using response surface methodology.3 Biotech. 2018.
- Vyas P, Kumar A, Singh S. Biomass breakdown : A review on pretreatment, instrumentations and methods. Front Biosci. 2018;10:155–174.
- Raghunandan K, Mchunu S, Kumar A, Kumar KS, Govender A, Permaul K, Singh S, et al. Biodegradation of glycerol using bacterial isolates from soil under aerobic conditions. J Environ Sci Heal Part A Toxic/Hazardous Subst Environ Eng. 2014;49(1):85–92. doi: 10.1080/10934529.2013.824733
- Tiwari G, Sharma A, Dalela M, Gupta R, Sharma S, Kuhad RC. Microwave assisted alkali pretreatment of fruit peel wastes for enzymatic hydrolysis. Indian J Agric Sci. 2017;87(4):496–499.
- Tiwari G, Sharma A, Kumar A, Sharma S. Assessment of microwave-assisted alkali pretreatment for the production of sugars from banana fruit peel waste. Biofuels. 2018
- Gupta A, Kumar A, Sharma S, Vijay VK. Comparative evaluation of raw and detoxified mahua seed cake for biogas production. Applied Energy. 2013;102:1514–1521.
- Kumar A, Sharma S. Potential non-edible oil resources as biodiesel feedstock: An Indian perspective. Renew Sustain Energy Rev. 2011;15(4):1791-1800.
- Kothari R, Pandey A, Ahmad S, Kumar A, Pathak V V, Tyagi V V. Microalgal cultivation for value-added products: a critical enviro-economical assessment. 3 Biotech. 2017;7:243.
- Bhat MK. Cellulases and related enzymes in biotechnology. Biotechnol Adv. 2000;18(5):355-383.
- Raghunandan K, Kumar A, Kumar S, Permaul K, Singh S. Production of gellan gum, an exopolysaccharide, from biodiesel-derived waste glycerol by Sphingomonas spp. 3 Biotech. 2018;8(1):71. doi: 10.1007/s13205-018-1096-3
- Singh JK, Vyas P, Dubey A, Upadhyaya CP, Kothari R, Tyagi VV, Kumar A, et al. Assessment of different pretreatment technologies for efficient bioconversion of lignocellulose to ethanol. FrontBiosci-Sch. 2018;10:350-371.
- de Lima Brossi MJ, Jiménez DJ, Cortes-Tolalpa L, van Elsas JD. Soil-Derived Microbial Consortia Enriched with Different Plant Biomass Reveal Distinct Players Acting in Lignocellulose Degradation. Microb Ecol. 2016;71(3):616–627. doi: 10.1007/s00248-015-0683-7
- Khianngam S, Pootaeng-on Y, Techakriengkrai T, Tanasupawat S. Screening and identification of cellulase producing bacteria isolated from oil palm meal. J. Appl. Pharm. Sci. 2014;4(4):90–96.
- Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 1980;16(2):111–120.
- Letunic I, Bork P. Interactive tree of life ( iTOL ) v3 : an online tool for the display and annotation of phylogenetic and other trees. Nucleic Acid Res. 2016;44(1):242–245. doi: 10.1093/nar/gkw290
- Lokhande, S and Pethe AS. Isolation and screening of cellulolytic bacteria from soil and optimization of cellulase production and activity. Int J Life Sci. 2017;5(2):277–282.
- Gothwal R, Gupta A, Kumar A, Sharma S, Alappat BJ. Feasibility of dairy waste water (DWW) and distillery spent wash (DSW) effluents in increasing the yield potential of Pleurotus flabellatus (PF 1832) and Pleurotus sajor-caju (PS 1610) on bagasse. 3 Biotech. 2012;2(3):249–257.
- Singh NB, Kumar A, Rai S. Potential production of bioenergy from biomass in an Indian perspective. Renew Sustain Energy Rev. 2014;39:65–78.
- Kumar A, Kumar K, Kaushik N, Sharma S, Mishra S. Renewable energy in India: Current status and future potentials. Renew Sustain Energy Rev. 2010;14(8):2434–2442.
- Maki ML, Broere M, Leung KT, Qin W. Characterization of some efficient cellulase producing bacteria isolated from paper mill sludges and organic fertilizers. Int J Biochem Mol Biol. 2011;2(2):146–154.
- Sethi S, Datta A, Gupta BL, Gupta S, Sethi S, Datta A, et al. Optimization of Cellulase Production from Bacteria Isolated from Soil. Int Sch Res Not. 2013:e985685.








