2Department of education and health, Federal University of Sergipe, Lagarto/SE, Brazil
3Department of physiological sciences, Federal University of São Carlos, São Paulo/SP, Brazil
4Postgraduate education in Human Motricity Sciences, Department of physical education, São Paulo State University, Rio Claro/SP, Brazil
5Department of Clinical Analysis, School of Pharmaceutical Sciences, São Paulo State University, Araraquara/SP, Brazil
Propose: This study investigated the effects of irisin signaling pathway induced by Resistance Training (RT) in ovariectomized (Ovx) rats.
Methods: Thirty-two Holztman rats were randomly distributed to four experimental groups: Sham-Sedentary (Sed); Ovx-Sed; Sham-RT and Ovx-RT. The RT protocol demanded from the animals a vertical climb. Each session consisted of 4 to 12 climbs with 2 min. of rest during 12 weeks. To quantify mRNA expression the ΔΔCt method was applied, protein expression was verified by Western Blotting and the analysis of irisin was determined by ELISA. When group averages were different (p ≤ 0.05), a Tukey post-hoc test was applied.
Results: The Ovx-RT group had higher expression of PGC1α FNDC5, irisin levels, and UCP1 compared to Ovx-Sed.
Conclusion: RT was led to higher expression of the irisin signaling pathway in the Ovx group showing that the RT seems to be an excellent strategy to counteract the ovariectomy-induced metabolic disorders.
Keywords: PGC1-Α, FNDC5; Adipose Tissue; UCP1; Resistance Training
Physical exercise can be used as an intervention to improve the health of postmenopausal women given that that Resistance Training (RT) has been associated to decreases in fat mass and increases in lean body mass to prevent sarcopenia, cardiovascular diseases, type 2 diabetes and obesity [9-14]. These benefits occur in part because skeletal muscle is an endocrine organ and exercise stimulates skeletal muscle to produce and release myokines, which have endocrine functions [15]. Irisin is a remarkable myokine and its concentration seems to increase in response to both endurance training and RT [16-20]. During physical exercise, the release of this moykine is induced by the activation of PPARγ co-activator 1 alpha (PGC1-α), which stimulates the fibronectin type III domain containing 5 (FNDC5) to cleave and release irisin into the blood [16].
Irisin is bound to unidentified receptors in the surface of white fat adipocytes and positively regulates the release of UCP1 (Uncoupling Protein 1), which provokes uncoupling in mitochondrial respiration and loss of energy in the form of heat and browning of the White Adipose Tissue (WAT) [16,21,22]. In addition, irisin could stimulate energy expenditure through modulation of hypothalamic neuropeptides and neurotransmitters involved in feeding control [23]. Thus, the thermogenic changes in white adipose tissue may play an important protective role against metabolic disorders, such as cardiovascular diseases, type-2 diabetes and obesity [24,25]. In view of these benefits, the activation of the irisin pathway could play an important protective role against the deleterious effects caused by reduced levels of estrogen. However, to date there are no studies that demonstrate the effect of RT on the irisin signaling pathway in Ovariectomized (Ovx) rats. Our hypotheses in the present study were: 1) the irisin signaling pathway would be lower in Ovx rats, and 2) the Sham and Ovx rats would have greater irisin signaling pathway after RT.
Gene |
Forward Primer |
Reverse Primer |
Access number |
PGC-1α |
GGCCCGGTACAGTGAGTGTT |
ATTGCTCCGGCCCTTTCTT |
NM_031347.1 |
FNDC5 |
CTCTTCATGTGGGCAGGTGTC |
GCTGGTCTCTGATGCACTCTTG |
NM_001270981.1 |
UCP1 |
GGCATCCAGAGGCAAATCAGC |
CCAATGAATACCGCCACGCC |
NM_012682.2 |
GAPDH |
GATGCTGGTGCTGAGTATGTCG |
GTGGTGCAGGATGCATTGCTGA |
NM_017008.3 |
Experimental Groups |
Sham-Sed |
Ovx-Sed |
Sham-RT |
Ovx-RT |
Body Weight (g) |
312.71 ± 16.66 |
373.98 ± 20.70* |
311.29 ± 8.75 |
355.93 ± 15.44* &# |
Left Gastrocnemius (g) |
1.56 ± 0.14 |
1.66 ± 0.12 |
1.65 ± 0.10 |
1.85 ± 0.10* &# |
Mesenteric Fat (g) |
2.99 ± 0.064 |
3.45 ± 0.33* |
1.92 ± 0.33* |
3.08 ± 0.55& |
17β-Estradiol (pg/ml) |
34.05 ± 0.28 |
14.91 ± 0.56* |
34.13 ± 0.28 |
14.63 ± 0.51* & |
Uterus Mass (mg) |
0.65 ± 0.14 |
0.09 ± 0.02* |
0.62 ± 0.06 |
0.09 ± 0.02* & |
The groups that performed RT presented higher (p ≤ 0.05) PGC1-α mRNA expression when compared to their sedentary control groups. The Ovx-RT group presented higher (p ≤ 0.05) PGC1-α mRNA expression compared to Sham-Sed groups (Figure 1). FNDC5 mRNA expression (Figure 2a) was higher (p ≤ 0.05) on trained animals compared to their sedentary control groups. The date of FNDC5 protein expression (Figure 2b) was also higher (p ≤ 0.05) on trained animals compared to their sedentary control groups.
*(p < 0.05) compared to Sham-Sed;
& (p < 0.05) compared to Sham-RT;
# (p < 0.05) compared to Ovx-Sed.
*(p < 0.05) compared to Sham-Sed;
& (p < 0.05) compared to Sham-RT;
# (p < 0.05) compared to Ovx-Sed.
*(p < 0.05) compared to Sham-Sed;
# (p < 0.05) compared to Ovx-Sed.
When Ovx-RT was compared to Sham-Sed group the irisin concentration was significantly higher (p ≤ 0.05). UCP1 protein expression in mesenteric fat (Figure 4b) presented higher values (p ≤ 0.05) in Sham-RT group compared to Sham-Sed. The Ovx-RT group presented higher (p ≤ 0.05) mRNA and protein expression of UCP1 compared to the Ovx-Sed group. Finally, Ovx- RT presented higher (p ≤ 0.05) protein expression of UCP1 compared to Sham-Sed (Figure 4).
The results on gene expression of PGC1-α in the Ovx-Sed group represent that low estrogen levels could have a negative impact on skeletal muscle energy metabolism as mitochondria are estrogen-sensitive organelles [36]. This result corroborates with the findings of Barbosa, Shiguemoto, et al. which seems to be the first study to present some changes in mitochondrial function in an experimental model of menopause [37]. Our results strengthen the evidence that reduction of estrogen levels is a problem of female physiology that requires further investigation. Thus, our results suggest a link between ovariectomy and reduction of PGC1-α expression in the muscle.
*(p < 0.05) compared to Sham-Sed;
& (p < 0.05) compared to Sham-RT;
# (p < 0.05) compared to Ovx-Sed.
The results of UCP1 gene and protein expression in mesenteric fat of the Ovx-Sed group (Figure 4a,b) were lower when compared to the Sham group. This result shows part of the deleterious effects caused by reduced estrogen, once UCP1 expression is related to changes in the thermogenesis of WAT [24]. Nowadays, there are no studies in the literature that show these results, however, according to Pedersen, Bruun, et al. ovariectomy induces lower expression of the UCP1 gene in BAT [47]. Furthermore, our study confirms these findings on the effects of ovariectomy leading to lower UCP1 expression in the WAT of Ovx-Sed rats. Our results show that in the Ovx-Sed group, even in normal irisin concentrations it does not produce the same stimulatory effect of UCP1 expression. As demonstrated in a previous study, the lower expression of UCP1 in brown adipose tissue seems to be associated with reduced levels of estrogen in rats [47]. Our study is the first to demonstrate that despite the fact that irisin levels are not impaired by the reduction of estradiol, UCP1 expression is reduced in Ovx-Sed rats. Thus, we can speculate that the Ovx- Sed group did not have a thermogenic effect of WAT, once body and mesenteric fat weights were significantly greater compared to the Sham-Sed group (Table 2).
- Maggio M, Lauretani F, Ceda GP. Sex hormones and sarcopenia in older persons. Curr Opin Clin Nutr Metab Care. 2013;16(1):3-13. doi: 10.1097/MCO.0b013e32835b6044
- Saha KR, Rahman MM, Paul AR, Das S, Haque S, Jafrin W, et al. Changes in lipid profile of postmenopausal women. Mymensingh Med J. 2013;22(4):706-711.
- Wietlisbach V, Marques-Vidal P, Kuulasmaa K, Karvanen J, Paccaud F, Project WM. The relation of body mass index and abdominal adiposity with dyslipidemia in 27 general populations of the WHO MONICA Project. Nutr Metab Cardiovasc Dis. 2013;23(5):432-442. doi: 10.1016/j.numecd.2011.09.002
- Awa WL, Fach E, Krakow D, Welp R, Kunder J, Voll A, et al. Type 2 diabetes from pediatric to geriatric age: analysis of gender and obesity among 120,183 patients from the German/Austrian DPV database. Eur J Endocrinol. 2012;167(2):245-254.
- Gregor MF, Hotamisligil GS. Inflammatory mechanisms in obesity. Annu Rev Immunol. 2011;29:415-445. doi: 10.1146/annurev-immunol-031210-101322
- Kalu DN. The ovariectomized rat model of postmenopausal bone loss. Bone Miner. 1991;15(3):175-191.
- Bunratsami S, Udomuksorn W, Kumarnsit E, Vongvatcharanon S, Vongvatcharanon U. Estrogen replacement improves skeletal muscle performance by increasing parvalbumin levels in ovariectomized rats. Acta Histochem. 2015;117(2):163-175. doi: 10.1016/j.acthis.2014.12.003
- Jung SR, Kim SH, Ahn NY, Kim KJ. Changes of bone metabolism based on the different interventions with exercise type or additional intake material in ovariectomized rats. J Exerc Nutrition Biochem. 2014;18(1):111-117. doi: 10.5717/jenb.2014.18.1.111
- Wang CH, Chung MH, Chan P, Tsai JC, Chen FC. Effects of endurance exercise training on risk components for metabolic syndrome, interleukin-6, and the exercise capacity of postmenopausal women. Geriatr Nurs. 2014;35(3):212-218. doi: 10.1016/j.gerinurse.2014.02.001
- Nunes PR, Barcelos LC, Oliveira AA, Furlanetto Junior R, Martins FM, Orsatti CL, et al. Effect of resistance training on muscular strength and indicators of abdominal adiposity, metabolic risk, and inflammation in postmenopausal women: controlled and randomized clinical trial of efficacy of training volume. Age (Dordr). 2016;38(2):40. doi: 10.1007/s11357-016-9901-6
- Botero JP, Shiguemoto GE, Prestes J, Marin CT, Do Prado WL, Pontes CS, et al. Effects of long-term periodized resistance training on body composition, leptin, resistin and muscle strength in elderly post-menopausal women. J Sports Med Phys Fitness. 2013;53(3):289-294.
- Egana M, Reilly H, Green S. Effect of elastic-band-based resistance training on leg blood flow in elderly women. Appl Physiol Nutr Metab. 2010;35(6):763-772. doi: 10.1139/H10-071
- Oliveira PF, Gadelha AB, Gauche R, Paiva FM, Bottaro M, Vianna LC, et al. Resistance training improves isokinetic strength and metabolic syndrome-related phenotypes in postmenopausal women. Clin Interv Aging. 2015;10:1299-1304. doi: 10.2147/CIA.S87036
- Rossi FE, Fortaleza AC, Neves LM, Buonani C, Picolo MR, Diniz TA, et al. Combined Training (Aerobic Plus Strength) Potentiates a Reduction in Body Fat but Demonstrates No Difference on the Lipid Profile in Postmenopausal Women When Compared With Aerobic Training With a Similar Training Load. J Strength Cond Res. 2016;30(1):226-234. doi: 10.1519/JSC.0000000000001020
- Pedersen BK, Febbraio MA. Muscles, exercise and obesity: skeletal muscle as a secretory organ. Nat Rev Endocrinol. 2012;8(8):457-465. doi: 10.1038/nrendo.2012.49
- Bostrom P, Wu J, Jedrychowski MP, Korde A, Ye L, Lo JC, et al. A PGC1-alpha-dependent myokine that drives brown-fat-like development of white fat and thermogenesis. Nature. 2012;481(7382):463-468. doi: 10.1038/nature10777
- Huh JY, Mougios V, Kabasakalis A, Fatouros I, Siopi A, Douroudos II, et al. Exercise-induced irisin secretion is independent of age or fitness level and increased irisin may directly modulate muscle metabolism through AMPK activation. J Clin Endocrinol Metab. 2014;99(11):E2154-61. doi: 10.1210/jc.2014-1437
- Norheim F, Langleite TM, Hjorth M, Holen T, Kielland A, Stadheim HK, et al. The effects of acute and chronic exercise on PGC-1α, irisin and browning of subcutaneous adipose tissue in humans. FEBS J. 2014;281(3):739-749. doi: 10.1111/febs.12619
- Kim HJ, Lee HJ, So B, Son JS, Yoon D, Song W. Effect of aerobic training and resistance training on circulating irisin level and their association with change of body composition in overweight/obese adults: a pilot study. Physiol Res. 2016;65(2):271-279.
- Kim HJ, So B, Choi M, Kang D, Song W. Resistance exercise training increases the expression of irisin concomitant with improved of muscle function in aging mice and human. Exp Gerontol. 2015;70:11-17. doi: 10.1016/j.exger.2015.07.006
- Castillo-Quan JI. From white to brown fat through the PGC-1α-dependent myokine irisin: implications for diabetes and obesity. Dis Model Mech. 2012;5(3):293-295. doi: 10.1242/dmm.009894
- Arias-Loste MT, Ranchal I, Romero-Gomez M, Crespo J. Irisin, a link among fatty liver disease, physical inactivity and insulin resistance. International journal of molecular sciences. Int J Mol Sci. 2014;15(12):23163-23178. doi: 10.3390/ijms151223163
- Ferrante C, Orlando G, Recinella L, Leone S, Chiavaroli A, Di Nisio C, et al. Central inhibitory effects on feeding induced by the adipo-myokine irisin. Eur J Pharmacol. 2016;791:389-394. doi: 10.1016/j.ejphar.2016.09.011
- Moon HS, Mantzoros CS. Regulation of cell proliferation and malignant potential by irisin in endometrial, colon, thyroid and esophageal cancer cell lines. Metabolism. 2014;63(2):188-193. doi: 10.1016/j.metabol.2013.10.005
- Sanchis-Gomar F, Lippi G, Mayero S, Perez-Quilis C, Garcia-Gimenez JL. Irisin: a new potential hormonal target for the treatment of obesity and type 2 diabetes. J Diabetes. 2012;4(3):196. doi: 10.1111/j.1753-0407.2012.00194.x
- Institute of Laboratory Animal Resources (US). Committee on Care and Use of Laboratory Animals. Guide for the care and use of laboratory animals. NIH publication. Bethesda, Md.: U.S. Dept. of Health and Human Services, Public Health Service; 1996.
- Hornberger TA Jr, Farrar RP. Physiological hypertrophy of the FHL muscle following 8 weeks of progressive resistance exercise in the rat. Can J Appl Physiol. 2004;29(1):16-31.
- Sambrook J, Maniatis T, Fritsch EF. Molecular cloning : a laboratory manual. 2nd ed. Libraries Australia: Cold Spring Harbor, N.Y. : Cold Spring Harbor Laboratory Press, 1989.
- Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-408.
- Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, et al. Measurement of protein using bicinchoninic acid. Anal Biochem. 1985;150(1):76-85.
- Matsushita H, Minami A, Kanazawa H, Suzuki T, Subhadhirasakul S, Watanabe K, et al. Long-term supplementation with young coconut juice does not prevent bone loss but rather alleviates body weight gain in ovariectomized rats. Biomed Rep. 2017;6(5):585-591. doi: 10.3892/br.2017.883
- Iwasa T, Matsuzaki T, Yano K, Yanagihara R, Tungalagsuvd A, Munkhzaya M, et al. The effects of chronic testosterone administration on body weight, food intake, and adipose tissue are changed by estrogen treatment in female rats. Horm Behav. 2017;93:53-61. doi: 10.1016/j.yhbeh.2017.05.008
- Rodrigues MFC, Ferreira FC, Silva-Magosso NS, Barbosa MR, Souza MVC, Domingos MM, et al. Effects of resistance training and estrogen replacement on adipose tissue inflammation in ovariectomized rats. Appl Physiol Nutr Metab. 2017;42(6):605-612. doi: 10.1139/apnm-2016-0443
- Hirschberg AL. Sex hormones, appetite and eating behaviour in women. Maturitas. 2012;71(3):248-56. doi: 10.1016/j.maturitas.2011.12.016
- Asarian L, Geary N. Sex differences in the physiology of eating. Am J Physiol Regul Integr Comp Physiol. 2013;305(11):R1215-67. doi: 10.1152/ajpregu.00446.2012
- Chen JQ, Delannoy M, Cooke C, Yager JD. Mitochondrial localization of ERalpha and ERbeta in human MCF7 cells. Am J Physiol Endocrinol Metab. 2004;286(6):E1011-22.
- Barbosa MR, Shiguemoto GE, Tomaz LM, Ferreira FC, Rodrigues MF, Domingues MM, et al. Resistance Training and Ovariectomy: Antagonic Effects in Mitochondrial Biogenesis Markers in Rat Skeletal Muscle. Int J Sports Med. 2016;37(11):841-848.
- Tsuchiya Y, Ando D, Takamatsu K, Goto K. Resistance exercise induces a greater irisin response than endurance exercise. Metabolism. 2015;64(9):1042-1050. doi: 10.1016/j.metabol.2015.05.010
- Ellefsen S, Vikmoen O, Slettalokken G, Whist JE, Nygaard H, Hollan I, et al. Irisin and FNDC5: effects of 12-week strength training, and relations to muscle phenotype and body mass composition in untrained women. Eur J Appl Physiol. 2014;114(9):1875-88. doi: 10.1007/s00421-014-2922-x
- Wu J, Cohen P, Spiegelman BM. Adaptive thermogenesis in adipocytes: is beige the new brown? Genes Dev. 2013;27(3):234-50. doi: 10.1101/gad.211649.112
- Zhang Y, Xie C, Wang H, Foss RM, Clare M, George EV, et al. Irisin exerts dual effects on browning and adipogenesis of human white adipocytes. Am J Physiol Endocrinol Metab. 2016;311(2):E530-41.
- Andersson T, Soderstrom I, Simonyte K, Olsson T. Estrogen reduces 11beta-hydroxysteroid dehydrogenase type 1 in liver and visceral, but not subcutaneous, adipose tissue in rats. Obesity (Silver Spring). 2010;18(3):470-475. doi: 10.1038/oby.2009.294
- Stotzer US, Rodrigues MF, Domingos MM, Silva GH, Duarte FO, Gatto CV, et al. Resistance training suppresses intra-abdominal fatty acid synthesis in ovariectomized rats. Int J Sports Med. 2015;36(3):226-233. doi: 10.1055/s-0034-1390494
- Panneerselvam S, Packirisamy RM, Bobby Z, Elizabeth Jacob S, Sridhar MG. Soy isoflavones (Glycine max) ameliorates hypertriglyceridemia and hepatic steatosis in high fat-fed ovariectomized Wistar rats (an experimental model of postmenopausal obesity). J Nutr Biochem. 2016;38:57-69. doi: 10.1016/j.jnutbio.2016.08.007
- Losurdo P, Grillo A, Panizon E, Zanetti M, Bardelli M, Biolo G, et al. Baroreflex sensitivity and central hemodynamics after omega-3 polyunsaturated fatty acids supplementation in an animal model of menopause. Vascul Pharmacol. 2015;71:65-69. doi: 10.1016/j.vph.2014.12.005
- Divakaruni AS, Brand MD. The regulation and physiology of mitochondrial proton leak. Physiology (Bethesda). 2011;26(3):192-205. doi: 10.1152/physiol.00046.2010
- Pedersen SB, Bruun JM, Kristensen K, Richelsen B. Regulation of UCP1, UCP2, and UCP3 mRNA expression in brown adipose tissue, white adipose tissue, and skeletal muscle in rats by estrogen. Biochem Biophys Res Commun. 2001;288(1):191-197.
- Jeremic N, Chaturvedi P, Tyagi SC. Browning of White Fat: Novel Insight Into Factors, Mechanisms, and Therapeutics. J Cell Physiol. 2017;232(1):61-68. doi: 10.1002/jcp.25450
- Rachid TL, Penna-de-Carvalho A, Bringhenti I, Aguila MB, Mandarim-de-Lacerda CA, Souza-Mello V. Fenofibrate (PPARalpha agonist) induces beige cell formation in subcutaneous white adipose tissue from diet-induced male obese mice. Mol Cell Endocrinol. 2015;402:86-94. doi: 10.1016/j.mce.2014.12.027
- Gomez-Hernandez A, Beneit N, Diaz-Castroverde S, Escribano O. Differential Role of Adipose Tissues in Obesity and Related Metabolic and Vascular Complications. Int J Endocrinol. 2016;2016:1216783.






