Mini Review Article
Open Access
Vaccine Against Entheropathogenic E. colii: A
Systematic Review
Halyka Luzório Franzotti Vasconcellos1*, Wilmar Dias da Silva1, Ivan Pereira Nascimento2 and
André Kipnis3
1Department of Immunochemistry, Butantan Institute, São Paulo, Brazil
2Department of Biotechnology, Butantan Institute, São Paulo, Brazil
3Department of Microbiology, Immunology, Parasitology and Pathology, Institute of Tropical Diseases and Public Health, Federal University of Goiás, Goiânia, Brazil
2Department of Biotechnology, Butantan Institute, São Paulo, Brazil
3Department of Microbiology, Immunology, Parasitology and Pathology, Institute of Tropical Diseases and Public Health, Federal University of Goiás, Goiânia, Brazil
*Corresponding author: Wilmar Dias da Silva, Department of Immunochemistry, Butantan Institute, São Paulo, Brazil, Tel. No: +55 (11) 2627-9722; Fax:+55 (11) 2627-9722;E-mail:
@
Received: : Received: : 12 April, 2017; Accepted: 10 May, 2017; Published: 20 May, 2017
Citation: Halyka Luzório Franzotti Vasconcellos, et.al. (2017) Vaccine Against Entheropathogenic E. colii: A Systematic Review. Int J Vaccine Res 2(2): 1-8. DOI: 10.15226/2473-2176/2/2/00120
Abstract
Enteric diseases are a major cause of childhood death in the developing world, ranking as the second cause of death in children. Enteropathogenic Escherichia coli(EPEC) are important diarrheal pathogens of children under 5 years of age. Due to high mortality, several international organizations such as the WHO and UNICEF have dedicated preventive and control programs for diarrheal diseases. Among the suggested initiatives aiming to prevent infectious diarrhea include vaccine development and improvement in sanitation and water and food supplies.
Upon contact with host cells, EPEC delivers an array of virulence protein factors, which integrated actions interferes with the normal adjusting the targets molecular cell functions leading to diarrhea. The locus of entherocyte effacement (LEE)pathogenicity island contains genes encoding synthesis of the EPEC virulence factors membrane adhesin intimin, T3SS (Esc and Sep proteins), chaperones (Ces proteins), translocators (EspA, EspB, and EspD), effector proteins (EspF, EspG, EspH, Map and EspZ), the translocated intimin receptor (Tir), and the regulatory protein Ler (LEEencoded regulator).Bundle-forming pilus (BfpA) is another virulence factor that mediates the initial contact between EPEC and the host cell. BfpA is encoded by a gene localized on a 50–70 MDa plasmid and is designated as EPEC adherence factor (EAF). BfpA, intimin and translocated Tir initiate EPEC infection. This repertoire of virulence factors offers strategic epitopes as vaccine candidates.
Employing the proposed technologies for modern vaccines, recombinant Mycobacterium smegmatis (Smeg) and Mycobacterium bovis BCG strains were constructed to express BfpA, intimin and EspA. Recombinant clones were selected based on kanamycin resistance. Recombinant proteins are immunogenic, and the resultant antibodies recognize and block EPEC adhesion onto HEp-2 target cells. In attention to regulatory agency recommendations, kanamycin should not be used to produce rBCG expressing the E. colii EPEC virulence factors BfpA, intimin and EspA. Accordingly, an expression system with a Pasteur auxotrophic BCG mutant for leucine (BCG Pasteur ΔleuD) and a replicative vector (pUP410)should be used. Obtained recombinants will be grown in large scale, and their immunogenic effectivity and human safety submitted to WHO indicated quality controls.
Keywords: Diarrhea; Escherichia coli; Virulence factors; Immune response; Immunoglobulins recombinants.
Upon contact with host cells, EPEC delivers an array of virulence protein factors, which integrated actions interferes with the normal adjusting the targets molecular cell functions leading to diarrhea. The locus of entherocyte effacement (LEE)pathogenicity island contains genes encoding synthesis of the EPEC virulence factors membrane adhesin intimin, T3SS (Esc and Sep proteins), chaperones (Ces proteins), translocators (EspA, EspB, and EspD), effector proteins (EspF, EspG, EspH, Map and EspZ), the translocated intimin receptor (Tir), and the regulatory protein Ler (LEEencoded regulator).Bundle-forming pilus (BfpA) is another virulence factor that mediates the initial contact between EPEC and the host cell. BfpA is encoded by a gene localized on a 50–70 MDa plasmid and is designated as EPEC adherence factor (EAF). BfpA, intimin and translocated Tir initiate EPEC infection. This repertoire of virulence factors offers strategic epitopes as vaccine candidates.
Employing the proposed technologies for modern vaccines, recombinant Mycobacterium smegmatis (Smeg) and Mycobacterium bovis BCG strains were constructed to express BfpA, intimin and EspA. Recombinant clones were selected based on kanamycin resistance. Recombinant proteins are immunogenic, and the resultant antibodies recognize and block EPEC adhesion onto HEp-2 target cells. In attention to regulatory agency recommendations, kanamycin should not be used to produce rBCG expressing the E. colii EPEC virulence factors BfpA, intimin and EspA. Accordingly, an expression system with a Pasteur auxotrophic BCG mutant for leucine (BCG Pasteur ΔleuD) and a replicative vector (pUP410)should be used. Obtained recombinants will be grown in large scale, and their immunogenic effectivity and human safety submitted to WHO indicated quality controls.
Keywords: Diarrhea; Escherichia coli; Virulence factors; Immune response; Immunoglobulins recombinants.
Introduction
Vaccines – Immunization
Vaccines are modified infectious agents that, upon
injection into susceptible hosts, induce specific protection
but not infection. These agents are prepared as either killed,
inactivated, or attenuated entire pathogens, maybe: as toxins or
certain strategic molecules involved in pathogen survival and
multiplication in infected hosts. Therefore, vaccination is a nonnatural
procedure to induce an effective immune response.
The history of vaccines began with the observation that some humans and animals who recovered from infections become partially or even completely resistant to infection with the same or related infectious agents. The explosion of infectious diseases such as plague caused by Yersinia pestis, tuberculosis caused by Mycobacterium tuberculosis, infantile paralysis caused by poliovirus, and influenza caused by the influenza virus, which cause disability and mortality, accelerated the development of new vaccines. Since earlier times, three general qualities should be expressed by any vaccine candidate: safety, efficacy and feasibility.
In 1798, Edward Jenner, observing that milkmaids who contact edcowpox-virus-infected cows after having had local mild infections became protected against the smallpox virus responsible for one of the gravest human infections, decided to introduce systematic immunization using person-to-person inoculation with cowpox virus. Although the cowpox-derived vaccine reduced smallpox transmission in Europe and North America, the infection transmission persisted in developing countries. The introduction of a stable, freeze-dried smallpox virus vaccine was the solution. Consequently, the vaccinology became established [1]. In 1885, Louis Pasteur attenuated the rabies virus and developed the rabies vaccine [2]. In 1927, a Mycobacterium bovis strain was attenuated, and the vaccine Bacillus Calmette- Guérin (BCG) against Mycobacterium tuberculosis infection was created [3]. Next, samples of Vibrio cholera, Salmonellae typhi and Yersinia pestis were killed, and vaccines against cholera, typhoid fever and plague diseases became available [4,5]. This still small vaccine repertoire was rapidly increased with the production of some inactivated toxins, the toxoids, resulting in the diphtheria and tetanus vaccines [6-8]. Data on Table 1 indicates the actual vaccines stage.
With the introduction of cell culture in biological research allowing large-scale virus growth, the Salk and Sabin polio vaccines were developed [9]. Improvements in vaccine preparations aiming to increase their immunogenicity and to reduce the remaining pathogenicity were stimulated by the accumulative, solid knowledge regarding the cellular and molecular mechanisms involved in the immune response. Remarkable was the demonstration that memory instead of naïve T and B cells require 10-50 fewer antigens to respond to immunization; their receptors have a high affinity to the specific epitope and appear to have a longer life span [10-12]. B cells expressing somatically VL(J):VH(D)J molecular rearrangements, upon contact with the specific epitopes, differentiate into longlived memory and plasma cells [13].
The yellow fever vaccine, comprising an attenuated virus, was empirically developed [14]. A single injection induces cytotoxic T lymphocytes and T helper Th1-Th2 differentiation, aside from the production of neutralization antibody. Effective immunity persists for up to 30 years. To investigate the refined mechanisms involved in immune response induction by the yellow fever vaccine, the multiplex analysis of cytokines-chemokines and multi-parameter flow cytometry combined with computational modelling were applied to identify the yellow fever virus response signature in immunized humans. This possibly demonstrates that systems biology approaches not only permit the observation of a global picture of vaccine-induced innate immune responses but also can be used to predict the magnitude of the subsequent adaptive immune response and uncover new correlates of vaccine efficacy [15]. A method for obtaining high-affinity anti- HIV monoclonal antibodies was developed by cloning human B cells [16]. The obtained data may permit the identification of correct epitopes in vaccines that induce high specific and affinity antibodies. Current vaccine states are in Table1.
The history of vaccines began with the observation that some humans and animals who recovered from infections become partially or even completely resistant to infection with the same or related infectious agents. The explosion of infectious diseases such as plague caused by Yersinia pestis, tuberculosis caused by Mycobacterium tuberculosis, infantile paralysis caused by poliovirus, and influenza caused by the influenza virus, which cause disability and mortality, accelerated the development of new vaccines. Since earlier times, three general qualities should be expressed by any vaccine candidate: safety, efficacy and feasibility.
In 1798, Edward Jenner, observing that milkmaids who contact edcowpox-virus-infected cows after having had local mild infections became protected against the smallpox virus responsible for one of the gravest human infections, decided to introduce systematic immunization using person-to-person inoculation with cowpox virus. Although the cowpox-derived vaccine reduced smallpox transmission in Europe and North America, the infection transmission persisted in developing countries. The introduction of a stable, freeze-dried smallpox virus vaccine was the solution. Consequently, the vaccinology became established [1]. In 1885, Louis Pasteur attenuated the rabies virus and developed the rabies vaccine [2]. In 1927, a Mycobacterium bovis strain was attenuated, and the vaccine Bacillus Calmette- Guérin (BCG) against Mycobacterium tuberculosis infection was created [3]. Next, samples of Vibrio cholera, Salmonellae typhi and Yersinia pestis were killed, and vaccines against cholera, typhoid fever and plague diseases became available [4,5]. This still small vaccine repertoire was rapidly increased with the production of some inactivated toxins, the toxoids, resulting in the diphtheria and tetanus vaccines [6-8]. Data on Table 1 indicates the actual vaccines stage.
With the introduction of cell culture in biological research allowing large-scale virus growth, the Salk and Sabin polio vaccines were developed [9]. Improvements in vaccine preparations aiming to increase their immunogenicity and to reduce the remaining pathogenicity were stimulated by the accumulative, solid knowledge regarding the cellular and molecular mechanisms involved in the immune response. Remarkable was the demonstration that memory instead of naïve T and B cells require 10-50 fewer antigens to respond to immunization; their receptors have a high affinity to the specific epitope and appear to have a longer life span [10-12]. B cells expressing somatically VL(J):VH(D)J molecular rearrangements, upon contact with the specific epitopes, differentiate into longlived memory and plasma cells [13].
The yellow fever vaccine, comprising an attenuated virus, was empirically developed [14]. A single injection induces cytotoxic T lymphocytes and T helper Th1-Th2 differentiation, aside from the production of neutralization antibody. Effective immunity persists for up to 30 years. To investigate the refined mechanisms involved in immune response induction by the yellow fever vaccine, the multiplex analysis of cytokines-chemokines and multi-parameter flow cytometry combined with computational modelling were applied to identify the yellow fever virus response signature in immunized humans. This possibly demonstrates that systems biology approaches not only permit the observation of a global picture of vaccine-induced innate immune responses but also can be used to predict the magnitude of the subsequent adaptive immune response and uncover new correlates of vaccine efficacy [15]. A method for obtaining high-affinity anti- HIV monoclonal antibodies was developed by cloning human B cells [16]. The obtained data may permit the identification of correct epitopes in vaccines that induce high specific and affinity antibodies. Current vaccine states are in Table1.
Table 1: Microbiologic Characteristics of Brucella suis strain 353-1.a
Needed vaccines: Developed vaccines
|
Effective Vaccines Work by Eliciting Effector and Memory
Immune Responses that Confer Protection Against
Infection and Disease.
T cells are actively involved in both humoral and cellular
immune responses. They are derived from hematopoietic stem
cells (HSCs) first in the foetal liver during embryogenesis and
later postnatally in the bone marrow as pluripotent common lymphoid
progenitors (CLPs). HSCs, after sequential differentiation
stages, yield immature T lymphocytes that migrate and maturate
in the thymus. In parallel, the T lymphocyte cell surface TCRs alternatively
express CD8 glycoprotein CD8+T cells (T Cytotoxic) or
CD4 glycoprotein CD4+T cells (Helper T Cells). CD4+T cells further
differentiate into subsets: Th1, Th2, Th9, Th17, Th22, Treg
(Regulatory T Cells), and Tfg (Follicular Helper T Cells). Each
subset is characterized by different cytokine profiles: Th1, IFN-γ
and TNF; Th2, IL-4, IL-5, IL-13;Th9, Il-9; Th17, IL-17, IL-21, IL-22,
IL-25, IL-26; Th22, IL-22; Treg (Regulatory T Cells), IL-10, TGF-β;
Tfg, IL-21 (Follicular Helper T Cells) [17]. Upon contact with
pathogen antigens, naïve CD4+ T cells multiply and differentiate into effector cells and migrate to the infected tissue sites [18].
In contrast withnaïve short-lifeCD4+ T, memory subsetsCD4+ T sub-sets are long-lived cells. Re-exposure to the pathogen antigens causes memory CD4+ T sub-sets to undergo rapid expansion and to exhibit a potent capacity to eliminate the infectious pathogens. The previous expansion and activation persist even in the absence of the antigen and are potentiated upon antigen re-exposure [19,20].
B cells are also derived from HSCs, initially residing in the embryo, then in the foetal liver and spleen, and finally in the bone marrow (which, after birth, is the preferential residence) as mature naïve B cells. Ten developmental stages initiates from HSPs and maturate to naïve B cells (MNBs) in where are identified by the presence of cell surface markers: HSP → common lymphoid progenitor (CLPs) →pro-B cell (ProB)→pre-B-1-cell (pre-B-1) →pre-B-2-cell (pre-B-II-1)→ pre-B-II-2→ pre-B-II- 3→immature naïve B cell (ImnB) →mature naïve B cell (MNB) that leaves the bone marrow and migrates to secondary lymphoid tissues, including the lymph nodes, tonsils, Peyer`s patches, and spleen [20-22].
In contrast withnaïve short-lifeCD4+ T, memory subsetsCD4+ T sub-sets are long-lived cells. Re-exposure to the pathogen antigens causes memory CD4+ T sub-sets to undergo rapid expansion and to exhibit a potent capacity to eliminate the infectious pathogens. The previous expansion and activation persist even in the absence of the antigen and are potentiated upon antigen re-exposure [19,20].
B cells are also derived from HSCs, initially residing in the embryo, then in the foetal liver and spleen, and finally in the bone marrow (which, after birth, is the preferential residence) as mature naïve B cells. Ten developmental stages initiates from HSPs and maturate to naïve B cells (MNBs) in where are identified by the presence of cell surface markers: HSP → common lymphoid progenitor (CLPs) →pro-B cell (ProB)→pre-B-1-cell (pre-B-1) →pre-B-2-cell (pre-B-II-1)→ pre-B-II-2→ pre-B-II- 3→immature naïve B cell (ImnB) →mature naïve B cell (MNB) that leaves the bone marrow and migrates to secondary lymphoid tissues, including the lymph nodes, tonsils, Peyer`s patches, and spleen [20-22].
Naïve B cell Life Span is Approximately 1-4 Days.
In secondary lymphoid tissues, germinative centre
B cells (GCBs) recall a robust secondary immune response in a
cohort of switched-memory B cells upon new contact with the antigen. BCRs are structurally remodelled after a transcriptional
four-stage program, resulting in switched-memory B cells. The
resultant BCRs express a higher specificity and affinity to the
epitopes and enhance durable immune protection in comparison
with those previously expressed by naïve BCRs [22]. The Figure 1
highlights distinctions among naïve and memory B cells.
Figure 1: This figure highlight distinctions among naïve and memory B cells
Cellular and molecular knowledge regarding the basic
immune response allowing the deciphering of the human immune
response mechanisms governing the differentiation of T and B
cells expressing high specific-affinity cellular receptors must be
observed in vaccinology. In association with emerging data from
related technologies such as the identification of new high immunogenic
epitope vaccine antigens, discovery of new adjuvants,
development of high-throughput technologies for identifying the
best epitope combining paired VH:VL and epitope signatures on
mRNA and DNA sequences after vaccine antigen exposures are
fuelling a revolution in vaccinology [23,24]. Accumulate capacity
to sequence whole genomes of microorganisms and to utilize bioinformatics
for designing vaccines is a relatively recent approach
to antigen discovery and has been termed “reverse vaccinology”
[25]. Proteins and peptides are the building blocks of life and are
now evolving as a very promising brand of therapeutic entities.
The generation of stable vectors expressing the desired epitopes
is the goal of modern vaccine technology. The inclusion of encoding
genes of relevant epitopes into living, non-infective vectors
that constitutively express immunological adjuvant components
would be ideal. Attenuated bacteria have been used as vectors
to express and deliver heterologous antigens. This type of vaccine
vector is an attractive system because it can elicit mucosal,
humoral and cellular host immune responses to foreign antigens
[26]. These live vectors have been used extensively to express antigens
of different types of pathogens, including viruses, bacteria
and parasites, some of which have demonstrated positive results
[27]. However, each vector has its unique features that should be
considered before being used.
Diarrhea Epidemiology and Pathogenesis
The “Bill & Melinda Gates Foundation” (BMGF) in collaboration
with the “Center for Vaccine Development of the University
of Maryland School of Medicine” CVDUMSM) has retrieved
worldwide epidemiologic pediatric diarrhea data [28].
Sub-Saharan Africa, Pakistan, and South Asian countries’ populations were selected. Groups of children 0-11, 12-23 and 24-59 months totalling 47,000 from Kenia, Mali, Mozambique, Bangladesh, India and Pakistan were followed up for 36 months. Morbidity and mortality were evaluated. The clinical follow-up used typical diarrhea symptoms such as simple gastroenteritis, enteritis, persistent liquid diarrhea vomiting and acute crisis. EPEC and ETEC cause simple gastroenteritis. Shigella, Campylobacter jejuni, Entamoeba histolytica and Non-thyroid Salmonellai, cause enteritis. Vibrio cholerae and ETEC cause profuse diarrhea. The pediatric lethality index caused by diarrhea in Brazil is higher [29]. Gastrointestinal Infections (GIs) are among the leading causes of childhood mortality worldwide and are responsible for millions of deaths every year; India has surpassed Brazil (200.0000) [30-32]. Among the causative agents are several pathotypes of non-invasive Escherichia coli that cause diarrhea but do not produce heat-labile or heat-stable enterotoxins [33].
In Brazil, the most prevalent diarrhea-associated pathotypes among children are the typical entero aggregative and atypical enteropathogenic types of Escherichia coli [34]. Typical (tEPEC) and atypical (aEPEC) enteropathogenic Escherichia coli strains are the main diarrhea infectious agents [35-37]. The complex mechanisms involved in EPEC-induced infection initiate with bacterial virulence factor synthesis by EPEC once approaching enterocyte target cells [38]. The EPEC adheres to the external membrane of enterocytes, causing the typical “attaching and effacing” (A/E) lesion [39].
As indicated, diarrhea remains one of the top causes of death in low-and middle-income countries, in children under 5 years of age [35,36]. A wide range conditions can be responsible for this illness. EPEC strains are among the main bacterial causes of this disease [35,36]. EPEC adheres to the host cells and induces attaching and effacing (A/E) lesions, culminating in the induction of diarrhea [39]. The formation of A/E lesions involves a type III secretion system encoded on a pathogenicity island locus of enterocyte effacement (LEE), which is responsible for delivering several pathogenic factors into host cells [38]. Intimin is a 94–97 kDa protein expressed on the EPEC surface that mediates EPEC adhesion to epithelial gut cells, which in turn mediate intimate contact with the bacterial translocated intimin receptor (Tir) [40]. The integration of enteropathogenic E. colii virulence factors on epithelial cell surface and subsequent pedestal formation is schematically represented on (Figure 2).
Sub-Saharan Africa, Pakistan, and South Asian countries’ populations were selected. Groups of children 0-11, 12-23 and 24-59 months totalling 47,000 from Kenia, Mali, Mozambique, Bangladesh, India and Pakistan were followed up for 36 months. Morbidity and mortality were evaluated. The clinical follow-up used typical diarrhea symptoms such as simple gastroenteritis, enteritis, persistent liquid diarrhea vomiting and acute crisis. EPEC and ETEC cause simple gastroenteritis. Shigella, Campylobacter jejuni, Entamoeba histolytica and Non-thyroid Salmonellai, cause enteritis. Vibrio cholerae and ETEC cause profuse diarrhea. The pediatric lethality index caused by diarrhea in Brazil is higher [29]. Gastrointestinal Infections (GIs) are among the leading causes of childhood mortality worldwide and are responsible for millions of deaths every year; India has surpassed Brazil (200.0000) [30-32]. Among the causative agents are several pathotypes of non-invasive Escherichia coli that cause diarrhea but do not produce heat-labile or heat-stable enterotoxins [33].
In Brazil, the most prevalent diarrhea-associated pathotypes among children are the typical entero aggregative and atypical enteropathogenic types of Escherichia coli [34]. Typical (tEPEC) and atypical (aEPEC) enteropathogenic Escherichia coli strains are the main diarrhea infectious agents [35-37]. The complex mechanisms involved in EPEC-induced infection initiate with bacterial virulence factor synthesis by EPEC once approaching enterocyte target cells [38]. The EPEC adheres to the external membrane of enterocytes, causing the typical “attaching and effacing” (A/E) lesion [39].
As indicated, diarrhea remains one of the top causes of death in low-and middle-income countries, in children under 5 years of age [35,36]. A wide range conditions can be responsible for this illness. EPEC strains are among the main bacterial causes of this disease [35,36]. EPEC adheres to the host cells and induces attaching and effacing (A/E) lesions, culminating in the induction of diarrhea [39]. The formation of A/E lesions involves a type III secretion system encoded on a pathogenicity island locus of enterocyte effacement (LEE), which is responsible for delivering several pathogenic factors into host cells [38]. Intimin is a 94–97 kDa protein expressed on the EPEC surface that mediates EPEC adhesion to epithelial gut cells, which in turn mediate intimate contact with the bacterial translocated intimin receptor (Tir) [40]. The integration of enteropathogenic E. colii virulence factors on epithelial cell surface and subsequent pedestal formation is schematically represented on (Figure 2).
Figure 2: EPEC adheres to the target cells, induces attaching and effacing (A/E) lesions, culminating with diarrhea. This figure depicts the sequential association of the EPEC virulence factors BfpA, Intimin, Tir, EspA, EspB and EspD encoded by plasmids specific genes and expressed by the bacteria (top of the figure). Once bacteria approaching epithelial cell surface BfpA stablishes weak contact but sufficient of allowing transfer the Tir-EspA-EspB- EspD complex and Intimin to the external target cell surface. Along the Tir-EspA-EspB-EspD complex migration to cell cytoplasm an intra membrane tube is created and fixed by EspA. Once internalized the resulting Tir-EspB-EspD complex mediates pedestal formation (bottom of the figure).
The N-terminal region is conserved among the different
intimin subtypes, while the C-terminal regions are highly variable.
The 29 intimin subtypes are identified according to their
C-terminal amino acid sequences [40-46]. Intimin-β is the most
common subtype expressed in EPEC isolates [44-46,56]. Bundle-
Forming Pilus (BfpA) is another virulence factor, which mediates
the initial contact between EPEC and the host cell [47]. BfpA is
encoded by a gene localized on a plasmid 50–70 MDa in size and
is designated as EPEC adherence factor (EAF) [48,49]. Within adherent
micro-colonies of EPEC, BfpA organizes a meshwork that
allows bacteria to attach to each other and to tether themselves
to the host cell surface [48]. The EspA (E. colii secreted protein A)
filament, a hollow tube that acts like a molecular syringe for delivery
of the Tir (translocated intimin receptor) protein and other
effector molecules into the host cell, it is an excellent immunodiagnostic
target for infant diarrhoea caused by EPEC. It is a key
virulence factor present in all EPEC strains, it can be induced to
high levels in culture and its structure makes it accessible from
all sides to antibodies [50]. Therefore, BfpA, Intimin and EspA are
three important virulence factors and are considered strategic
target candidates for designing a new vaccine against EPEC. The
generation of stable vectors expressing the desired immunogens
is the goal of modern vaccine technology. The inclusion of genes
encoding relevant epitopes into living, non-infective vectors
that constitutively express immunological adjuvant components
would be ideal. Attenuated bacteria have been used as vectors
to express and deliver heterologous antigens. This type of vaccine
vector is an attractive system because it can elicit mucosal,
humoral and cellular host immune responses to foreign antigens
[51].
These live vectors have been used extensively to express antigens of different types of pathogens, including viruses, bacteria and parasites, some of which have demonstrated positive results [52]. However, each vector has its unique features that should be considered before it is used.
These live vectors have been used extensively to express antigens of different types of pathogens, including viruses, bacteria and parasites, some of which have demonstrated positive results [52]. However, each vector has its unique features that should be considered before it is used.
Gene Vectors.
Bacillus Calmette-Guerin (BCG) is a strain of Mycobacterium
bovis that was empirically attenuated along 1906 to 1920 by
repeated cultivation on a glycerinated bile-potato medium. Bacillus
samples recovered after the last cultivation were inoculated
in mice, guinea pigs, calves, rhesus monkeys, chimpanzees, and
virulence and immunogenicity evaluated by available standard
methods. Although virulence was completely abrogated the immunogenicity
was preserved. Recent analysis using refined molecular
analyses it was verified that BCG samples underwent the
loss and/or rearrangement of several gene complexes [52]. In
1928, after experimental evaluations, BCG was recommended by
the League of Nations as the official vaccine against human tuberculosis
(TB). Since then, it remains the only official and commercially
available vaccine against TB [56].
BCG offers unique advantages as a vaccine: (1) it is unaffected by maternal antibodies, and therefore, it can be given at any time after birth; (2) BCG is usually given as a single dose eliciting a long-lasting immunity; (3) it is stable and safe; (4) BCG can be administrated orally; and (5) it is inexpensive in comparison with other live vaccines [53]. In addition, the extraordinary adjuvant properties of some bacterial intrinsic mycobacterial cell components make them an attractive vector for the development of recombinant vaccines [54].
The interest in BCG increased considerably in the 1990s as a result of the development of different genetic systems for the expression of foreign antigens in mycobacteria. These systems include the development of different shuttle vectors, and systems to express and secrete heterologous antigens. Moreover, technological advancements in the genomics of mycobacteria have improved our understanding of the biology of this slow-growing pathogen and have helped the conception of strategies to evaluate BCG as a vaccine delivery vector [57]. Consequently, antigens of bacteria, parasites, and viruses have been expressed in BCG and it has been shown that recombinant BCG (rBCG) elicits both cellular and humoral immune responses against heterologous antigens [54-56]. However, it was only in recent years that rBCG has attracted more attention as consequences stimulated by initiatives to develop new vaccines against TB. It has been demonstrated that rBCG over expressing antigens of M. tuberculosis is more efficient in conferring protection against tuberculosis than the wild type BCG strain [55].
BCG offers unique advantages as a vaccine: (1) it is unaffected by maternal antibodies, and therefore, it can be given at any time after birth; (2) BCG is usually given as a single dose eliciting a long-lasting immunity; (3) it is stable and safe; (4) BCG can be administrated orally; and (5) it is inexpensive in comparison with other live vaccines [53]. In addition, the extraordinary adjuvant properties of some bacterial intrinsic mycobacterial cell components make them an attractive vector for the development of recombinant vaccines [54].
The interest in BCG increased considerably in the 1990s as a result of the development of different genetic systems for the expression of foreign antigens in mycobacteria. These systems include the development of different shuttle vectors, and systems to express and secrete heterologous antigens. Moreover, technological advancements in the genomics of mycobacteria have improved our understanding of the biology of this slow-growing pathogen and have helped the conception of strategies to evaluate BCG as a vaccine delivery vector [57]. Consequently, antigens of bacteria, parasites, and viruses have been expressed in BCG and it has been shown that recombinant BCG (rBCG) elicits both cellular and humoral immune responses against heterologous antigens [54-56]. However, it was only in recent years that rBCG has attracted more attention as consequences stimulated by initiatives to develop new vaccines against TB. It has been demonstrated that rBCG over expressing antigens of M. tuberculosis is more efficient in conferring protection against tuberculosis than the wild type BCG strain [55].
Vaccine Anti - E. colii
E. colii EPEC recombinants
Enteropathogenics Escherichia coli (EPEC) are an important
cause of diarrhea in children. EPEC adheres to the intestinal
epithelium and causes attaching and effacing (A/E) lesions.
Recombinant Mycobacterium smegmatis (Smeg) and Mycobacterium
bovis BCG strains were constructed to express either BfpA
or intimin. The entire bfpA gene and a portion of the Intimin gene
were amplified by PCR from EPEC genomic DNA and inserted
into the pMIP12 vector at the BamHI/KpnI sites. The pMIP bfpA
and pMIP Intimin vectors were introduced separately into Smeg
and BCG. Recombinant clones were selected based on kanamycin
resistance and designated rSmeg pMIP (bfpA or intimin) and
rBCG pMIP (bfpA or intimin). The expression of bfpA and intimin
was detected by Immunoblotting using polyclonal anti-BfpA and
anti-Intimin antibodies. The immunogenicity of these proteins
was assessed in C57BL/6 mice by assaying the feces and serum
for the presence of anti-BfpA and anti-Intimin IgA and IgG antibodies.
TNF-α and INF-y were produced in vitro by spleen cells
from mice immunized with recombinant BfpA, whereas TNF-α
was produced in mice immunized with recombinant Intimin. The
adhesion of EPEC (E2348/69) to HEp-2 target cells was blocked
by IgA or IgG antibodies from mice immunized with recombinant
BfpA or Intimin but not by antibodies from non-immunized mice.
Immunogenic non-infectious vectors containing relevant EPEC
virulence genes may be promising vaccine candidates [58].
Other vaccine candidates proved to be effective against EPEC. Immunization of cattle with a combination of recombinant EspA, Intimin and Tir have been demonstrated to be protective against E. colii O157 challenge [59]. Lactobacillus casei expressing intimin-β fragments and containing the immune dominant epitopes of Int280 induced both humoral and cellular immune responses in mice. The antibodies were able to bind to EPEC and inhibit bacterial adhesion to the epithelial cell surface in vitro [60]. The mixed vaccine including ETEC, EHEC, EIEC, EAEC and EPEC, induces protection against the five E. colii pathotypes [61].
Other vaccine candidates proved to be effective against EPEC. Immunization of cattle with a combination of recombinant EspA, Intimin and Tir have been demonstrated to be protective against E. colii O157 challenge [59]. Lactobacillus casei expressing intimin-β fragments and containing the immune dominant epitopes of Int280 induced both humoral and cellular immune responses in mice. The antibodies were able to bind to EPEC and inhibit bacterial adhesion to the epithelial cell surface in vitro [60]. The mixed vaccine including ETEC, EHEC, EIEC, EAEC and EPEC, induces protection against the five E. colii pathotypes [61].
Clinical Assay
The experimental data covering E. colii EPEC virulence
factors deeply involved in the bacterial attachment onto target
cells, the proper plasmids encoding them, the feasible vectors,
and reliable molecular methods for detecting the presence of the
genes inside vectors, up-to-date assays for identifying developed
recombinant proteins and quantifying their activities justify attempts
to use the obtained BCG-BfpA-Intimin recombinants for
developing a new anti-EPEC vaccine.
The clinical development of a new vaccine begins with a plan [62]. The plan must comprise three phases: Phase 1, Phase 2 and Phase 3.
A pre-clinical assay using experimental animals must anticipate trials in human subjects. Local and systemic undesirable reactions such as inflammation, pain, discomfort, tumour markers, and specific signals to the proposed vaccine epitopes are the focus.
Phase 1, comprises submission of the proposed vaccine previously approved in the pre-clinical assay to a first human assay enrolling 50 subjects. This involves detecting human reactogenicity by evaluating local and general inflammation and immunogenicity measurement by the emergence of specific antibodies and T cells to vaccine epitopes.
In Phase 2, several hundred subjects and multiple variable clinical centres must be enrolled. In this phase, blinding, minimum and maximal vaccine doses and vaccine-cost must also be considered.
Phase 3, extends observations on the proposed vaccine that has been previously considered safe and protective after Phases 1 and 2 [63]. For additional information on the proposed clinical vaccine, several items, such as ethical principles, risks and inconveniences, subjects’ rights, scientific and technology availability of the product under test, and medical care for the selected subjects, must be observed (Table 1). Principles of Good Clinical (practicity) as proposed [64]. The randomized, controlled clinical trial (RCT) is considered a gold-standard design to follow-up vaccine performance [65]. The formula used to determine the sample sizes in two-group trials is available [66].
The clinical development of a new vaccine begins with a plan [62]. The plan must comprise three phases: Phase 1, Phase 2 and Phase 3.
A pre-clinical assay using experimental animals must anticipate trials in human subjects. Local and systemic undesirable reactions such as inflammation, pain, discomfort, tumour markers, and specific signals to the proposed vaccine epitopes are the focus.
Phase 1, comprises submission of the proposed vaccine previously approved in the pre-clinical assay to a first human assay enrolling 50 subjects. This involves detecting human reactogenicity by evaluating local and general inflammation and immunogenicity measurement by the emergence of specific antibodies and T cells to vaccine epitopes.
In Phase 2, several hundred subjects and multiple variable clinical centres must be enrolled. In this phase, blinding, minimum and maximal vaccine doses and vaccine-cost must also be considered.
Phase 3, extends observations on the proposed vaccine that has been previously considered safe and protective after Phases 1 and 2 [63]. For additional information on the proposed clinical vaccine, several items, such as ethical principles, risks and inconveniences, subjects’ rights, scientific and technology availability of the product under test, and medical care for the selected subjects, must be observed (Table 1). Principles of Good Clinical (practicity) as proposed [64]. The randomized, controlled clinical trial (RCT) is considered a gold-standard design to follow-up vaccine performance [65]. The formula used to determine the sample sizes in two-group trials is available [66].
Pre-Clinical Assay rBCG-EPEC Vaccine
In attention to the regulatory agency recommendations,
the rBCG expressing the E. colii EPEC virulence factors BfpA and
Intimin by our described method using kanamycin was modified
using an expressing system with a Pasteur auxotrophic BCG
mutant for leucine (BCG Pasteur ΔleuD) and a replicative vector
(pUP410) that supplement constructions instead of leucine
[58,67]. With this expression of BfpA, Intimin and EspA recombinants
using specific primers, the normal development and maintenance
of memory cells during vaccination will be preserved
[68]. This strategy is based on the BCG ΔleuD ability to multiply
inside macrophages only in the presence of complementation
[69].
Encompassing modern vaccine proposed technologies recombinant Mycobacterium smegmatis (Smeg) and Mycobacterium bovis BCG strains were initially constructed to express either BfpA or Intimin. The bfpA and Intimin (eae) genes were amplified by polymerase chain reaction (PCR). The EPEC E2348/69 prototype genomic DNA was used as a template, and the constructed oligonucleotide primers were as follows:
bfpA (FP 5-TAG GGA TCC CTG TCT TTG ATT GAA TCT GCA ATG GTG CTT-3- and RP 5-TAG GGT ACC TTA CTT CAT AAA ATA TGT AAC TTT ATT GGT-3 -.
intimin fp 5-TAG GGA TCC GGG ATC GAT TAC C-3 -and RP 5-TAG GGT ACC TTT ATC AGC CTT AAT CTC A-3-.
espa14: PF: GCTCTAGAGCATACATCAACTACAGCAT; P15PR: CCC AAGCTTTTATTTACCAAGGGA;P16:RP: GGGTACCTTATTTACCAAG GGATA;P17:PF: GCGGATCCCATACATCAACT -.
The underlined regions indicate kpnI and BamHI sites. Briefly, the amplified BfpA and Intimin (eae) PCR products were purified and sub-cloned into the pGEM-T Easy vector (Promega, USA). Both genes were digested with BamHI and Kpnl and subcloned into the mycobacterial vector pMIP12 (kindly provided by Brigitte Gicquel, Pasteur Institute, France). The resulting plasmids were identified as pMH12-bfpA and pMH12-intimin. The plasmids were validated by successive analyses with restriction endonucleases and DNA sequencing using the primer 5-TTC AAA CTA TCG CCG GCT GA-3-[58].
Encompassing modern vaccine proposed technologies recombinant Mycobacterium smegmatis (Smeg) and Mycobacterium bovis BCG strains were initially constructed to express either BfpA or Intimin. The bfpA and Intimin (eae) genes were amplified by polymerase chain reaction (PCR). The EPEC E2348/69 prototype genomic DNA was used as a template, and the constructed oligonucleotide primers were as follows:
bfpA (FP 5-TAG GGA TCC CTG TCT TTG ATT GAA TCT GCA ATG GTG CTT-3- and RP 5-TAG GGT ACC TTA CTT CAT AAA ATA TGT AAC TTT ATT GGT-3 -.
intimin fp 5-TAG GGA TCC GGG ATC GAT TAC C-3 -and RP 5-TAG GGT ACC TTT ATC AGC CTT AAT CTC A-3-.
espa14: PF: GCTCTAGAGCATACATCAACTACAGCAT; P15PR: CCC AAGCTTTTATTTACCAAGGGA;P16:RP: GGGTACCTTATTTACCAAG GGATA;P17:PF: GCGGATCCCATACATCAACT -.
The underlined regions indicate kpnI and BamHI sites. Briefly, the amplified BfpA and Intimin (eae) PCR products were purified and sub-cloned into the pGEM-T Easy vector (Promega, USA). Both genes were digested with BamHI and Kpnl and subcloned into the mycobacterial vector pMIP12 (kindly provided by Brigitte Gicquel, Pasteur Institute, France). The resulting plasmids were identified as pMH12-bfpA and pMH12-intimin. The plasmids were validated by successive analyses with restriction endonucleases and DNA sequencing using the primer 5-TTC AAA CTA TCG CCG GCT GA-3-[58].
Concluding Remarks
Childhood diarrhea continues to cause suffering in developing
countries. Viruses and bacteria are included among the
causative agents. Poor living conditions such as low quality of water
and poor food and healthcare systems are perversely associated
with aggravation of the problem. Safe, low-cost and efficient vaccines that are already available may be the solution. Important
details on infectious agent biology and molecular constitution are
also available. A BCG bacillus expressing E. colii EPEC strategic
virulence factors, BfpA and Intimin was constructed associating
genetic and immunologic properties rescued from the original
pathogenic bacteria with modern molecular biology methods following
scientific requirements. The construction is prepared for
clinical assay using as the expression system a Pasteur auxotrophic
BCG mutant for leucine (BCG Pasteur δleuD) and a replicative
vector (pUP410) that supplements constructions instead of
kanamycin. The unavailability of public or private resources is,
however, the next difficulty.
Acknowledgments
We would like to thank the following individuals: Dr.
LucianaC.C. Leite, Butantan Institute, São Paulo, Brazil, for her
assistanceand permission to use the Laboratory of Biotechnology
IV; Dr.Brigitte Gicquel, Institute Pasteur, Paris, France, for
providing the pMIP12 vector; Dr Odir Dellagostin, for providing
the pUP410, pUS2000 and pUS977; Dr. Albert Schriefer, Fiocruz
Institute, Salvador, Brazil, for providing the original enteropathogenic
E. colii (EPEC)-EAF(+) and-EAF(-) strains; and Dr. Dunia Rodriguez
for expertlaboratory help and assistance in our results.
This work was supported by grants from the following: CNPq,
forthe fellowship to the post-graduate student Halyka Luzorio
Franzotti Vasconcellos; FAPERJ, “Programa-Cientistas de Nosso
Estado”,Proc. No.: E-26/100.628/200; CNPq: Bolsa de Produtividade
(WDS) Nivel 1A, Proc. No: 301836/2005-1, FAPESP Proc.
No.: 09/52804-0and BZG.
Integraed Project: Center for Research on Toxins, Imune- Response and Cell Signaling – CeTICS /FAPESP (Grant # 2013/07467-1).
Principal Investigator: Hugo Aguirre Harmelin, IBu.
Sub-Project: Design of Antivenoms Based on Antibody Complementarity- Determining Regions DNA and Amino Acid Sequences.
Conflict of Interest Statement: The authors have no financial conflictof interest. This research is under the scope of the InternationalPatents WO 07030901, IN248654, ZA2008/02277, KR 1089400 andMX297263.
Integraed Project: Center for Research on Toxins, Imune- Response and Cell Signaling – CeTICS /FAPESP (Grant # 2013/07467-1).
Principal Investigator: Hugo Aguirre Harmelin, IBu.
Sub-Project: Design of Antivenoms Based on Antibody Complementarity- Determining Regions DNA and Amino Acid Sequences.
Conflict of Interest Statement: The authors have no financial conflictof interest. This research is under the scope of the InternationalPatents WO 07030901, IN248654, ZA2008/02277, KR 1089400 andMX297263.
ReferencesTop
- Plotkin SA. A short history of vaccination. In: Stanley Plotkin. 1999;111(34):12283-12287. doi: 10.1073/pnas.1400472111
- Pasteur L. Method to prevent rabies after biting. C. R. Acad Sci Paris. 1885;101:765-774
- Paris HJ. A History of Immunization. 1965;London: E&S Livingstone.
- Salmon DE. The theory of immunity from contagious diseases. Proc Am Assoc Adv Sci. 1886;11(9):241-245
- Salmon DE, Smith T. On a new method ofproducing immunity from contagious disease. Am Vet Rev. 1986;10:63-69
- Ramon G. On the flocculant power and on the immunizing properties of dioxtric toxoid made anatoxic (anatoxin). C. R. Acad Sci Paris. 1923;177:1338-1340
- Ramon G, Zoeller C. The antigenic value of tetanus toxoid in human. C. R. Acad. Sci. Paris. 1926;182:245-247
- Ramon G, Zoeller C. 1927. Tetanus toxoid and the active immunization of the home against tetanus. Ann. Inst. Pasteur Paris. 41:803 -833.
- Robbins FC, Daniel TM. A history of poliomyelitis. In Polio, TM Daniel and FC Robbins, Eds. 1997;5-22. Rochester, NY: University of Rochester Press.
- Ahmed R, Gray D. Immunobiological memory and protective immunity: understanding their relation. Science. 1996;272(5258):54-60
- Busch DH, Pamer EG. T cell affinity maturation by selective expansion during infection. J Exp Med. 1999;189(4):701-710
- Sun JC, Beilke JN, Lanier LL. Immune memory redefined: characterizing the longevity of natural killer cells. Immunol Rev. 2010;236:83-94. doi: 101111/j 16000-65X.2010.00900.x
- Dorner T, Radbruch A. Antibodies and B cell memory in viral immunity. Immunity. 2007;27(3):384-392
- Theiler M, Smith HH. The use of yellow fever modified by in vitro cultivation for human immunization. J Exp Med. 1937;65(6):787-800
- Querec TD, Akondy RS, Lee EK, Cao W, Nakaya HI, Teuwen D, Pirani A, Gernert K, Deng J, Marzolf B, Kennedy K, Wu H, Bennouna S, Oluoch H, Miller J, Vencio RZ, Mulligan M, Aderem A, Ahmed R, Pulendran B.2009. Nat Immunol. 2009 Jan;10(1):116-25. doi: 10.1038/ni.1688.
- Scheid JF, Mouquet H, Feldhahn N, Walker BD, Pereyra F, Cutrell E, et al. A method for identification of HIVgp 140 binding memory B cells in human blood. J Immunol Methods. 2009;343(2):65-67. doi: 10.1016/j.jim.2008.11.012
- Raphael I, Nalawade S, Eagar TN, Forsthuber TG. T cells subsets and their signature cytokines in autoimmune and inflammatory diseases. Cytokine. 2015;74(1):5-17. doi: 10.1016/j.cyto.2014.09.011
- Golubovskaya V, Wu L. Different subsets of T cells, memory, effector functions, and CART-T immunotherapy. Cancers (Basel). 2016;8(3):pii:E36. doi: 3390/cancers8030036
- Rosenblum MD, Way SS, Abbas AK. Regulatory T cell memory. Nat Rev Immunol. 2016:16(2):90–101. doi: 10.1038/nri.2015.1
- McHeyzer-Williams LJ, Milpied PJ, Okitsu SL, McHeyzer-Williams MG. Class-switched memory B cells remodel BCRs within secondary germinal centers. Nature Immunol. 2015;16(3):296-305. doi: 10.1038/ni 3095
- Hardy R, Hayakawa K. B cell development pathways. Annu Rev Immunol. 2001;19:595-621. doi: 10.1146/annurev.immunol.19.1.595
- Cooper, MD. The early history of B cells. Nature Rev Immunol. 2015;15(3):191-197. doi: 10.1038/nri3801
- DeKosky BJ, Ippolito GC, Deschner RP, Lavinder JJ, Wine Y, Rawlings BM, et al. High-throughput sequencing of the paired human immunoglobulin heavy and light chain repertoire. Nature Biotechnology. 2013;31(2):166-169. doi: 10.1038/nbt.2492
- Koff WC, Burton DR, Johnson PR, Walker BD, King CR, Nabel GJ, et al. Accelerating Next Generation Vaccine Development for Global Disease Prevention. Science. 2013;340(6136):1232910. doi: 10.1126/science.1232910
- Rappuoli R. Reverse vaccinology. Curr Opin Microbiol. 2000;5:445-50.
- Aldovini A, Young RA. Humoral and cell-mediated immune responses to live 399 recombinant BCG-HIV vaccines. Nature. 1991;351(6326):479–482. doi: 10.1038/351479a0
- Ohara N, Yamada T. Recombinant BCG vaccines. Vaccine; 19:4089-98.
- Levine MM, Kotloff KL, Nataro JP, Muhsen K. The global enteric multicenter study (GEMS): inpetus, rationale, and genesis). 2012;55(Suppl 4):S215-S224. doi: 10.1093/cid/cis761
- Andrade, Oliveira, Fagundes-Neto. Lethality in hospitalized children with acute diarrhea - risk factors associated with death. Rev Ass Med. Brazil. 1999;45(2):121-127
- Black RE, Cousens S, Johnson HL, Lawn JE, Rudan I, Bassani DG, et al. Global, regional, and national causes of child mortality in 2008: a systematic analysis. Lancet. 2010;375(9730):1969-1987. doi: 10.1016/S0140-6736(10)60549-1
- Rajendran P, Ajjampur SSR, Chidambaram D, Chandrabose G, Thangaraj B, Sarkar R, et al. Pathotypes of diarrheagenic Escherichia coli in children attending a tertiary care hospital in South India. Diagn Microbiol Infect Dis. 2010;68(2):117-122. doi: 10.1016/j.diagmicrobio.06.003
- Rodrigues J, Acosta VC, Candeias JM, Souza LO, Filho FJ. Prevalence of diarrheogenic Escherichia coli and rotavirus among children from Botucatu, Sao Paulo State, Brazil. Braz J Med Biol Res. 2002;35:1311–1318. doi: 10.1590/S0100-879X2002001100008
- Levine MM, Bergquist. EJ, Nalin DR, Waterman DH, Hornick RB, Young CR, et al. Escherichia coli strains that cause diarrhoea but do not produce heat-labile or heat-stable enterotoxins and are non-invasive. Lancet. 1978;1(8074):1119-1122
- Araujo. JM, Tabarelli GF, Arand KRS, Fabbricotti SH, Fagundes-Neto U, Mendes CMF, Scaletsky ICA. Typical Enteroaggregative and atypical enteropathogenic types of Escherichia coli are the most prevalent diarrhea-associated pathotypes among Brazilian Children. J Clin Microbiol. 2007;45:3396-3399. doi: 10.1128/JCM.00084-07
- Clark S, Haigh R, Freestone P, Williams P. Virulence of enteropathogenic Escherichia coli, a global pathogen. Clin Microbiol Rev. 2003;16(3):365–378
- Alrifai SB, Alsaadi A, Mahmood YA, Ali AA, Al-Kaisi LA. Prevalence and etiology of nosocomial diarrhea in children 5 years in Tikrit teaching hospital. East Mediterr Health J. 2009;15(5):1111–1118
- Donnenberg MS, Giron JA, Nataro JP, Kaper JB. A plasmid-encoded type IV fimbrial gene of enteropathogenic Escherichia coli associated with localized adherence. Mol Microbiol. 1992;6(22):3427–3437
- Jerse AE, Yu J, Tall BD, Kaper JB. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc Natl Acad Sci U. S. A. 1990;87(20):7839–784
- Donnenberg MS, Giron JA, Nataro JP, Kaper JB. A plasmid-encoded type IV fimbrial gene of enteropathogenic Escherichia coli associated with localized adherence. Mol Microbiol. 1992;6(22):3427–3437
- Kenny B. Phosphorylation of tyrosine 474 of the enteropathogenic Escherichia coli (EPEC) Tir receptor molecule is essential for actin nucleating activity and is preceded by additional host modifications. Mol Microbiol. 1999;31(4):1229–1241
- Fitzhenry R, Pickard D, Hartland EL, Reece S, Dougan G, Phillips AD, et al. Intimin type influences the site of human intestinal mucosal colonisation by enterohaemorrhagic Escherichia coli O157:H7. Gut. 2002;50(2):180-185
- Ito.K, M. Iida, M. Yamazaki, K. Moriya, S. Moroishi, J. Yatsuyanagi, et al. Intimin types determined by heteroduplex mobility assay 433 of intimin gene (eae)- positive Escherichia coli strains. J Clin Microbiol. 2007;45(3):1038–1041. doi: 10.1128/JCM.01103-06
- Mora A, Blanco M, Yamamoto D, Dahbi G, Blanco JE, Lopez C, et al. HeLa-cell adherence patterns and actin aggregation of enteropathogenic Escherichia coli (EPEC) and Shiga-toxin-producing E. coli (STEC) strains carrying different eae and tir alleles. Int Microbiol. 2009;12(4):243–251
- Aidar-Ugrinovich L, Blanco J, Blanco M, Blanco JE, Leomil L, Dahbi G, et al. Serotypes, virulence genes, and intimin types of Shiga toxin-producing Escherichia coli (STEC) and enteropathogenic E. coli (EPEC) isolated from calves in Sao Paulo, Brazil. Int J Food Microbiol. 2007;115(3):297–306. doi: 10.1016/j.ijfoodmicro.2006.10.046
- Oswald E, Schmidt H, Morabito S, Karch H, Marches O, Caprioli A. Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a new intimin variant. Infect Immun. 2000;68(1):64-71
- Ramachandran V, Brett K, Hornitzky MA, Dowton M, Bettelheim KA, Walker MJ, et al. Distribution of Intimin Subtypes among Escherichia coli Isolates from Ruminant and Human Sources. J Clin Microbiol. 2003;41(11)5022-5032. doi: 10.1128/JCM.41.11.5022-5032.2003
- Giron JA, Ho AS, Schoolnik GK. An inducible bundle forming pilus of enteropathogenic Escherichia coli. Science. 1991;254(5032):710-713
- Baldini MM, Kaper JB, Levine MM, Candy DC, Moon HW. Plasmid-mediated adhesion in enteropathogenic Escherichia coli. J Pediatr Gastroenterol Nutr. 1983;2(3):534–538
- Stone KD, Zhang HZ, Carlson LK, Donnenberg MS. A cluster of fourteen genes from enteropathogenic Escherichia coli is sufficient for the biogenesis of a type IV pilus. Mol Microbiol. 1996;20(2):325–337
- Crepin VF, Shaw R, Knutton, Frankel G. Molecular basis of antigenic polymorphism of EspA filaments: development of a peptide display technology. J Mol Biol. 2005;350(1):42–52. doi: 10.1016/j.jmb.2005.04.060
- Aldovini A, Young RA. Humoral and cell-mediated immune responses to live recombinant BCG-HIV vaccines. Nature. 1991;351(6326):479–482. doi: 10.1038/351479a0
- Ohara N, Yamada T. 2001. Recombinant BCG vaccines. Vaccine;19:4089–98.
- Bloom BR, Jacobs Jr WR. New strategies for leprosy and tuberculosis and for development of bacillus Calmette–Guerin into a multivaccine vehicle. Ann N Y Acad Sci. 1989;569:155–173
- Stover CK, de lC V, Fuerst TR, Burlein JE, Benson LA, Bennett LT, et al. New use of BCG for recombinant vaccines. Nature. 1991;351(6326):456–460. doi: 10.1038/351456a0
- Bastos RG, Borsuk S, Seixas FK, Dellagostin OA. Recombinant Mycobacterium bovis BCG. Vaccine. 2009;27(47):6495-6503. doi: 10.1016/j.vaccine.2009.08.044
- Ponnighause, JM, P. E. Fine, J. A. Sterne, R. J. Wilson, E, Msosa, P. J. Gruer, et al. Efficacy of BCG vaccine against leprosy and tuberculosis in northern Malawi. Lancet. 1992;3399(8794):636-639
- Dennehy M, Williamson AL. Factors influencing the immune response to foreign antigen expressed in recombinant BCG vaccines. Vaccine. 2005;23(10):1209–1224. doi: 10.1016/j.vaccine.2004.08.039
- Vasconcellos HLF, Scaramuzzia K, Nascimento IP, Da Costa Ferreira JM Jr, Abed CM, Piazza RMF, et al. Generation of recombinant bacillus Calmette–Guerin and Mycobacterium smegmatis expressing BfpA and intimin as vaccine vectors against enteropathogenic Escherichia coli. Vaccine. 2012;30(41):5999-6005. doi: 10.1016/j.vaccine.2012.05.083
- McNeilly TN, Mitchell MC, Rosser T, McAteer S, Low JC, Smith DGE, et al. Immunization of cattle with a combination of purified intimin-531, EspA and Tir significantly reduces shedding of Escherichia coli O157: H7 following oral challenge. Vaccine. 2009;28(5):1422-1428. doi: 10.1016/j.vaccine.2009.10.076
- Ferreira PCD, Silva JB, Piazza RMF, Eckmann L, Ho PL, Oliveira MLS. Immunization of mice with Lactobacillus casei expressing a beta-intimin fragment reduces intestinal colonization by Citrobacter rodentium. Clin Vaccine Immunol. 2011;18(11)1823–1833. doi: 10.1128/CVI.05262-11
- Gohar A, Nourtan F, Fahmy A, Amin MA. Development of safe, effective and immunogenic vaccine candidate for diarrheagenic Escherichia coli main pathotypes in a mouse model. BMC Res Notes. 2016;9:80. doi: 10.1186/s13104-016-1891-z
- Ballou WR.2003. 3-Trial Design for Vaccines. Part A. Clinical Development of New Vaccines: Phase 1 and Phase 2 Trials. Pages 85-93. In: The Vaccine Book. Eds: Barry R. Bloom and Paul-Henri Lambert. Elsevier Science-Academic Press
- Clemens JD, Koo HW. 2003. 3-Trial Design for Vaccines. Part B. Phase 3 Studies of Vaccines. Pages 95-117. In: The Vaccine Book. Eds: Barry R. Bloom and Paul-Henri Lambert. Elsevier Science-Academic Press.
- International Conference on Harmonisation. E6: Guideline for Good Clinical Practice. 1996
- Fayers P. Approaches to sample size estimation in the design of clinical trials- A review. By A. Donner, Statistics in Medicine, 3, 199-214 (1984) Stat Med. 1993;12(17):1643
- Armitage P. Statistical Methods in Medical Research. 1971. Oxford, UK: Blackwell
- Borsuk S, Mendum TA, Fagundes MQ, Michelon M, Cunha CW, McFadden J, et al. Auxotrophic complementation as a selectable marker for stable expression of foreign antigens in Mycobacterium bovis BCG. Tuberculosis (Edinb). 2007;87(6):474-480
- Mederle I, Bourguin I, Ensergueix D, Badell, E, Moniz-Peireira J, Gicquel B, et al. Plasmidic versus insertional cloning of heterologous genes in Mycobacterium bovis BCG: impact on in vivo antigen persistence and immune responses. Infect Immun. 2002;70(1):303–314
- Medeiros MA, Dellagostin OA, Armoa GR, Degrave WM, De Mendonca-Lima L, Lopes MQ, et al. 2002. Comparative evaluation of Mycobacterium vaccae as a surrogate cloning host for use in the study of mycobacterial genetics. Microbiology. 148(Pt 7):1999-2009. doi: 10.1099/00221287-148-7-1999




