Research Article Open Access
Evidence of Immune Genes in the Crinoid: Antedon Bifida Evidence of A. Bifida Igkappa Gene, Fc Receptor Gene
Michel Leclerc1*, Franck Letourneur, Dominique Davoult, Ariane Jolly and Pierre de la Grange
1Immunology of Invertebrates University of Orleans, France
*Corresponding author: Michel Leclerc, Immunology of Invertebrates University of Orleans, 556 rue Isabelle Romée, 45640 Sandillon, France, Email: @
Received: June 27, 2018; Accepted: July 10, 2018; Published: July 12, 2018
Citation: Michel L, Letourneur F, Davoult D, Jolly A, Grange PDL (2018) Evidence of Immune Genes in the Crinoïd: Antedon Bifida Evidence of A. Bifida Igkappa Gene, Fc Receptor Gene. Int J Vaccine Res 3(1): 1-2. DOI: 10.15226/2473-2176/3/1/00127
Abstract
Immuno-genomics studies realized in Echinodermata (Invertebrates) were surprising. 3 classes out of 5 Echinodermata presented an IGKappa gene and an Fc receptor gene. It was, first demonstrated, in Asterids and Ophuirids. It was, secondly clearly shown, in the ancestral Crinoïd: Antedon bifida.

Keywords: Invertebrates; Echinodermata; Crinoids; Igkappa Gene; Fc Gene; A. Bifida;
Introduction
The general idea that emerged from the experiments, made in our laboratory, was that Echinodermata, as exemplified, by sea star Asterias rubens (Asterids)and by Ophiocomina nigra (Ophuirids), possessed an immune system, able to mount cellular and humoral-specific responses,

After stimulation with a foreign antigen: the horse-radish peroxides (HRP) [1, 2]. Then, these echinodermata produced a primitive antibody, correlated to an Igkappa gene [3,4] to a Fab gene [5], an Fc receptor gene [6].But a question deserves to be put: did the ancestral Echinodermata, Antedon bifida, (Crinoïd) possess such genes? It is why, in a first time, we look for IgKappa gene, Fab gene, Fc receptor gene in these crinoids by the mean of genomic studies.
Materials and Methods
Animals
Antedon bifida was obtained at the station « Of Biologie Marine of Roscoff » France.
Obtention of crinoids mRNA
Digestive coeca were excised from the A. bifida body.

Bifida mRNA was obtained from Uptizol (Interchim). Quality control was operated.
Sequencing
Sequencing was made on Illumina Next Seq 500 with paired-end: 2. 75 bp Transcriptome was assembled from RNASeq fastq files using Trinity v2.1.1 [7] with default parameters. A BLAST database was created with the assembled transcripts using makeblastdb application from ncbi-blast+ (v2.2.31+). The sequences of transcripts of interest were then blasted against this database using blastn application from ncbi-blast+ [8] with parameter word size 7.
Results
The (Table 1) which is following summarizes the found Antedon bifida transcriptomes of Igkappa gene and Fc receptor gene of IgA (FCAR) of IgE (Fcer2a) we met in Homo sapiens and in Mus musculus:
Table 1: GenBank (IgK, FCAR, Fcer2a)

Query ID

Query Symbol

Species

Subject ID

Identity (%)

Length

Mis-match

Gap open

Query cover (%)

E-value

BC032451.1

Igk

Homo sapiens

TRINITY_DN9178_c0_g1_i2

89,74

78

7

1

8

4,00E-20

NM_133273.3

FCAR

Homo sapiens

TRINITY_DN13535_c0_g1_i1

79,31

87

13

5

4

5,00E-07

NM_001253737.1

Fcer2a

Mus musculus

TRINITY_DN20232_c5_g2_i1

84,31

51

7

1

2

8,00E-05

The Antedon bifida IgK transcriptome sequence is the one
>TRINITY_DN9178_c0_g1_i2(Igk):

5'AGCGAATGAAAAAGAAGAACCGGCCAAAAAAAGTACTTCTACCAAAGAAGCGAATGAAAAAGAAGAACC GGCCAAAAAAAGTACTTCTACCAAAGAAGAAACTGAAATAGAAGAACTAACCGAAACAAGTATTTCTACAA AATCAGTTTCTGCCAGTGATATATTCCTTGGTACAACTTTCACACTGGAGATGGGATTCTGCGTAGGACCT GAACACAAACCGTTTACAGGAGATTTCGACGGTGACGGTAATGAAGATCTTCTGTTTCACAATTCAAAGAC AGGCTCGAAAAAGATATACTATGCAAGTTGTGACGGCTCTTTTAATGGTGATAGGTCGTGGAGAAGAGAGA TGAATTTTTGCTACGTAAGTGGATATGATCTATACATTGGTGATTTCAACGGCGATGGTCGATCCGATATG CTGTGTCATCGTCCTCAGTATGGTCAGATTTGGGTTGTGTTGGCGCAACCTGGGGGTGTATTCACTGCTAA CCCGTGGTCGTATAGTCCCAATTGGTGCAAGGCCACCACTGATAAAGTATATATTGGAGACTTCAACGCAG ACGGTCGGGATGATATTCTTTGCCACACACAAAGTTCGGGTTACATTGCAATATATTATGCATTATACACT GGTTATTTTTCTACCTCTACAACATATCGCTTTACACGAAGTATGAGTTGGTGCAGAGGTACATATCAAAG AGTGTATACTGGAGATTTCAACGGAGACCGAAGGGTTGATATGCTCTGCCACGACTACTCATCTGGCTACA TATATGTAGCAGTAGCCACAGCGACTGGTGGATTCACCTCTGCCACATGGAGCAGAAGTATGGGCTGGTGC AAGCATTCGAACTCTAAGCTCAGCATTGGAGATTTCAATAAAGATAACCGCGACGACATCATGTGCAGCGA CACAAATGGTCCTTACTGGATAGCATTCTCTCTGTACAACGGTTCGTTTTCATCTAAAAGCTGGACCCGTA AACAAAACTGGTGTACATCTGGCAATGATGTGTTAGTTTCGGATGTGAATGGAGATGGTGGGGATGATTTG ATGTGCCATAATGAAGCCGACGGCATCAAGTACATATCGATCAACCATAAGGCCTAAAGCAAGTTCCTCTC AATATTACAGAAAACTATTCACCACAAATGATTCATTTTGTACTGAACCTCAATTCAAATTCAATTAAAAT TTACATAAACGTTAACGGAAGGATACAATCAACTAAAATAATGTTCATTCATTATTTTTCGTCGATAACCT AAACAAAAATCAGATAAGAAATTATACAATAATATACTGTAAACGTATTATACAAAATAATTAAATGTATA TTAAGCTACTGTACTTAGAAATGTACTTGTACGCTTATTAATATTAATAAGCCTAATGCCCGGGTTGATAA TAATAAAATACATTTTTGCAAGTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAACTCAAAAGTCCCAGGCCCCACCCCGACCTACTGAACCAGAAAG3'
The Antedon bifida Fc receptor (FCAR) transcriptome sequence is the one:
>TRINITY_DN13535_c0_g1_i1(FCAR)

5'ACTCTACGAACCAAATTTAAATATAACCCGAGAATGTATGTACAACCGATCCAGTAAAATGGTAACATTCAAG ACTACGATTATGTACCTTGTTAAATTAAAATAAAATAAAGTACCGGTAGATACACCATCATAAATATCAGCCTTT CATCAAGCAAAACAGTCATTTGTTTACAGTTCTGTCTTGAGTAGATGTTCTCAGCAAATTTTTCTAATATAACA ATTATAAACTTCTTGTGAAGATGAAATTTATTGATTTAATTGGATGCCAGTTAATTTTATTTAGAATTATTTTT AATTTTGATCTGAGAAACAGAATTAAGAACTGGAAAAGAAATGAACAAAAGTTTCCATAAAACTATCGTTATT CAATTTAGTTTGTTTCTATACAATGGCAAATTAACACTTTCAAGAGAGGTGCATATTTTTATTTTTGGTCAACT ATGCTTACAATAGGTAAAATAAAATATTAACATCCCCCTACCCTACTTACATCCCAACTTATCACGTAATAAACCT TATTTCTCTGTCGGGAAAATTTCAGATTTGAGCAAGTATAATTTTATTTATTATTTCAGAATGTTCTCTATTTTA ACTGGGTGCTTGATACAATTAACATTGTAGAAGTTTATTTGTTTATTTGTTTATTTGTTTGTTTGTTTGTTTGTT TAGATGGAGTTTCTCTCTTGTTGTCCAGGCTGGAGTGCAATGGCA3'
Discussion and Conclusion
Fortunaly, we find again in another Echinodermata, the IgKappa gene, the Fc receptor gene, we found in the Asterid: Asterias Rubens and in the Ophuirid: Ophiocomina nigra. Fab gene was found also in A.bifida, but the e-value was not significant. A considerable role may be assigned to crinoids IgKappa gene and Fc receptor gene: it is the one of Antedon bifida primitive antibody, but further research is needed in order, to examine and characterize the “immunocytochemical aspects of immunizations” to HRP (Horse-radish peroxides) or other antigen in Antedon bifida.

Nevertheless, for the third time, we find an invertebrate primitive antibody in an Echinodermata: it’s a great novelty!
ReferencesTop
  1. Leclerc M. Ultrastractural study of the reactions of asterina gilbbosa (Echinoderm Asteride) at the level of the axial organ after injection of proteins. Ann. Immunol. 1973;124:363-374.
  2. Leclerc M. Immunocyto chemical Reactions in the Brittle-Star: Ophiocomina Nigra after Immunization. Et al 2017, Int.J. Vaccines and Vaccine. 2017;4(4):00088
  3. Leclerc M. A True New Gene: An Invertebrate Antibody Igkappa Gene. Amer.J.Immunol. 2013;9(4):101-102.
  4. Leclerc M. Adaptative Immunity, a True New Gene in Ophiocomina Nigra: An Ophuirid Igkappa Gene. Cell. Cellular. Life. Sci.J. 2018;3(1):000117
  5. Leclerc M. Evidence of Fab Fragment Gene in an Invertebrate: The Sea Star Asterias Rubens. EC Microbiology. 2016;3(5):539-541.
  6. Leclerc, M. Evidence of CR Receptor Gene in an Invertebrate. EC Microbiology. 2016;4(5):759-760.
  7. Grabher MG. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nature Biotechnology. 2011;29(7):644-652.
  8. Altschul SF. Basic local alignment search tool. J.Mol.Biol. 1990;215(3):403-410.
 
Listing : ICMJE   

Creative Commons License Open Access by Symbiosis is licensed under a Creative Commons Attribution 3.0 Unported License