2,3,4,5Provincial Department of Naples, Regional Agency for Environmental Protection of Campania, Naples (Italy)
Keywords: Harmful; Microscopy; PCR; Monitoring;
Quantitative analysis was performed by counting cells in 2 transects, whole chamber or random fields, depending on sample cell density, from 100 to 400X magnification. The identification of taxa has been required standardized taxonomic literature [23,5]. Abundance of three species investigated was expressed as numbers of cells per liter. Macro algal samples were analyzed according to Protocol of ISPRA 2012. In order to allow dislodgement of epiphytic cells, macro algae samples were vigorously shaken for 2 minutes until the complete removal of cells. Fresh weight was measured after lightly blotting with tissue paper. The collected waters were then recovered in a beaker and macro algal rinsed three times with filtered sea water (0.45 μm). Washing seawater has been recovered together with collected water to form samples to analyze. A subsample of each fraction (ca 50 mL) was immediately placed on ice and then stored at -20°C for molecular analysis. 250 mL was preserved with 1 mL of Lugol’s solution and analyzed following Utermöhl Technique (UNI EN ISO 15204:2006) previously described.
Results were expressed as number of cell per g of fresh weight macroalgae (fw) using following formula: cell / g = [(c_count x F x vol_fin)/ vol_sed] / fw where 1- c_count correspond to counted cells; 2- F was the ratio chamber area/analyzed area (F=1 if whole chamber has been observed); 3- vol_fin was the final volume of samples (mL); 4- vol_sed correspond to sediment sample volume (mL); 5- fw was the Fresh Weight of thalli (g).
Purity and quality of extracted DNA was analyzed on a 0.8% agarose gel with 0.5% TAE Buffer, stained with GelRed (GelRed Nucleic Acid Gel Stain, Biotium). DNA quantification was performed with spectrophotometer NanoDrop 2000 (Thermo Fisher Scientific). PCR amplification was carried out using three sets of primers (Table 1) specific for the ITS-5.8S rDNA regions of genus and species Ostreopsis used in this study [18].
Primer set |
Primer |
Sequence 5’ → 3’ |
Target taxa |
Expected size of PCR product (bp) |
|
1 |
Forward |
Ostreopsis F |
AAAACGATATGAAGAGTGCAGC |
Ostreopsis spp. |
92 |
Reverse |
Ostreopsis R |
CCAGGAGTATGCCTACATTCAA |
|||
2 |
Forward |
Ovata F |
CAATGCTCATGTCAATGATG |
O. ovata |
210 |
Reverse |
Ostreopsis R |
CCAGGAGTATGCCTACATTCAA |
|||
3 |
Forward |
Siamensis F |
TGTTACCATTGCTGAGTTTG |
O.cf. siamensis |
223 |
Reverse |
Ostreopsis R |
CCAGGAGTATGCCTACATTCAA |
|||
An aliquot (4 μL) of PCR products were analyzed by electrophoresis in 2% agarose gel at a voltage of 70V for 1 hour. Gel were stained with GelRed (GelRed Nucleic Acid Gel Stain, Biotium) and visualized under UV illuminator, using a 100 bp DNA ladder (DNA Molecular Weight ladders, Amresco) as size marker. PCR products were purified using the QIAquick PCR Purification Kit - Qiagen and used as templates in sequencing reaction with the Big Dye Terminator V3.1 (Applied Biosystems) following manufacturer procedure. Sequencing was performed using an ABI Prism 3100 (Applied Biosystem) and sequences analyzed with Chromas Lite software, version 2.1.1. (Chromas Lite version 2.1, Technelysium; http://technelysium.com.au/?page_id=13) and submitted for Blast analysis to taxonomic affiliation.
In the seawater samples abundance of Ostreopsis spp. ranged from 0 cells L-1 in samples 1_W, 2_W, 13_W, 14_W, 15_W, 16_W, 19_W, 20_W, 21_W, 22_W, 23_W and 24_W, to a maximum of 8360 cells L-1 in sample 3_W. The lowest values detected have been 40 cells L-1 in sample 10_W. No cells of O. ovata were found in seawater samples, expect for 7_W, 8_W and 18_W. The highest and lowest values recorded were 2180 cell L-1 in sample 8_W and 180 cell L-1 in sample 18_W. About 50% seawater samples were positive for Ostreopsis spp. while O. ovata were found in 12, 5% of the water samples analyzed. For macroalgal samples 87, 5% and 66% were showing positive to Ostreopsis spp. and O. ovata.
Concentration of Ostreopsis spp. in macroalgal samples ranged from 0 cells g-1 in 13_M, 16_M and 19_M to a maximum of 109493 cells g-1 in 4_M. The lowest value was 38 cells g-1, observed in sample 20_M. Abundance of O. ovata ranged from 0 cells g-1 in samples 6_M, 11_M, 12_M, 15_M, 16_M, 17_M, 19_M and 22_M to a maximum of 66719 cells g-1 in sample 8_M. The lowest value was 42 cells g-1 in sample 2_M.
PCR assay was carried out in order to detect target taxa in samples analyzed.
Sample Number |
Sampling Period |
Microscopic Results (cells/L) |
Molecular Results (+/-) |
||||
Ostreopsis spp. |
Ostreopsis ovata |
O. cf. siamensis |
Ostreopsis spp. |
Ostreopsis ovata |
O. cf. siamensis |
||
1_W |
July |
n.d. |
n.d. |
n.d. |
+ |
– |
– |
2_W |
July |
n.d. |
n.d. |
n.d. |
+ |
– |
– |
3_W |
July |
8360 |
n.d. |
n.d. |
+ |
– |
– |
4_W |
July |
7820 |
n.d. |
n.d. |
+ |
– |
– |
5_W |
July |
2140 |
n.d. |
n.d. |
+ |
– |
– |
6_W |
July |
1260 |
n.d. |
n.d. |
+ |
– |
– |
7_W |
July |
2180 |
980 |
n.d. |
+ |
+ |
– |
8_W |
August |
2580 |
2180 |
n.d. |
+ |
+ |
– |
9_W |
August |
3440 |
n.d. |
n.d. |
+ |
– |
– |
10_W |
August |
40 |
n.d. |
n.d. |
+ |
– |
– |
11_W |
August |
100 |
n.d. |
n.d. |
+ |
– |
– |
12_W |
August |
200 |
n.d. |
n.d. |
+ |
– |
– |
13_W |
August |
n.d. |
n.d. |
n.d. |
– |
– |
– |
14_W |
August |
n.d. |
n.d. |
n.d. |
+ |
– |
– |
15_W |
September |
n.d. |
n.d. |
n.d. |
+ |
– |
– |
16_W |
September |
n.d. |
n.d. |
n.d. |
– |
– |
– |
17_W |
September |
3040 |
n.d. |
n.d. |
+ |
+ |
– |
18_W |
September |
520 |
180 |
n.d. |
+ |
+ |
– |
19_W |
September |
n.d. |
n.d. |
n.d. |
+ |
– |
– |
20_W |
September |
n.d. |
n.d. |
n.d. |
– |
– |
– |
21_W |
September |
n.d. |
n.d. |
n.d. |
+ |
+ |
– |
22_W |
October |
n.d. |
n.d. |
n.d. |
+ |
– |
– |
23_W |
October |
n.d. |
n.d. |
n.d. |
+ |
– |
– |
24_W |
October |
n.d. |
n.d. |
n.d. |
+ |
– |
– |
Sample Number |
Sampling Period |
Microscopic Results (cells/L) |
Molecular Results (+/-) |
||||
Ostreopsis spp. |
Ostreopsis ovata |
O. cf. siamensis |
Ostreopsis spp. |
Ostreopsis ovata |
O. cf. siamensis |
||
1_M |
July |
1947 |
127 |
n.d. |
+ |
+ |
– |
2_M |
July |
622 |
42 |
n.d. |
+ |
+ |
– |
3_M |
July |
71031 |
65684 |
n.d. |
+ |
+ |
– |
4_M |
July |
109493 |
63729 |
n.d. |
+ |
+ |
– |
5_M |
July |
11755 |
27487 |
n.d. |
+ |
+ |
– |
6_M |
July |
18236 |
n.d. |
n.d. |
+ |
– |
– |
7_M |
July |
65269 |
48429 |
n.d. |
+ |
+ |
– |
8_M |
August |
74219 |
66719 |
n.d. |
+ |
+ |
– |
9_M |
August |
58594 |
5771 |
n.d. |
+ |
+ |
– |
10_M |
August |
5932 |
641 |
n.d. |
+ |
+ |
– |
11_M |
August |
4119 |
n.d. |
n.d. |
+ |
– |
– |
12_M |
August |
2907 |
n.d. |
n.d. |
+ |
– |
– |
13_M |
August |
n.d. |
70 |
n.d. |
+ |
+ |
– |
14_M |
August |
1686 |
2490 |
n.d. |
+ |
+ |
– |
15_M |
September |
1984 |
n.d. |
n.d. |
+ |
– |
– |
16_M |
September |
n.d. |
n.d. |
n.d. |
+ |
– |
– |
17_M |
September |
9083 |
n.d. |
n.d. |
+ |
– |
– |
18_M |
September |
3463 |
11421 |
n.d. |
+ |
+ |
– |
19_M |
September |
n.d. |
n.d. |
n.d. |
+ |
– |
– |
20_M |
September |
38 |
107 |
n.d. |
+ |
+ |
– |
21_M |
September |
12977 |
21806 |
n.d. |
+ |
+ |
– |
22_M |
October |
689 |
n.d. |
n.d. |
+ |
– |
– |
23_M |
October |
2861 |
10758 |
n.d. |
+ |
+ |
– |
24_M |
October |
21306 |
17565 |
n.d. |
+ |
+ |
– |
After all, the study reveals that: 1-as the microscopic techniques was validated could be obtained a high-quality result. The calibration of method makes possible to prevent error related to critical phases that could invalidate the result of the analysis such as: homogenization, sedimentation, distribution of cells in the sedimentation area, the repeatability and the reproducibility of data; 2- the microscopic method required high-resolution equipment and updated taxonomical books. The analysts should be well-prepared to use microscopic techniques and have a good knowledge of taxonomy; they should be highly trained and up to date, because of highly intraspecific diversity due to the geographical variables for the researched species; 3-molecular biology techniques have been useful to identify O. ovata cells in natural samples, where there are other phytoplankton species. They are also very fast and safe. The use of commercially available kits allows to extract the genomic DNA in a few hours and to verify the result of the PCR amplification in a very short time. The main disadvantages of the molecular methods are the price of reagent and equipment as well as the absence of validated official methods. Furthermore molecular techniques don’ t allow the detection of live cells from dead ones so they can lead to an inaccurate result; 4-the reliability of data obtained from the molecular analysis is due to the usage of genus-specific and species-specific primer, which have no similarities with DNA regions belonging to different genus and species. Fast and reliable revelation methods are particularly important for environmental monitoring, in order to detect any critical case and potential risk due to the presence of toxic species. Nevertheless, in order to individuate algal bloom and to answer the specific requests of monitoring program the microscopic analysis allows obtaining an accurate quantification of harmful species, unlike the molecular methods used.
- Accoroni S, Romagnoli T, Colombo F, Pennesi C, Di Camillo CG, Marini M, et al. Ostreopsis cf. ovata bloom in the northern Adriatic Sea during summer 2009: ecology, molecular characterization and toxin profile. Marine Pollution Bulletin. 2011;62(11):2512-2519.
- Accoroni S, Romagnoli T, Pichierri S, Colombo F, Totti C. Morphometric analysis of Ostreopsis cf. ovata cells in relation to environmental conditions and bloom phases. Harmful Algae. 2012;19:15-22.
- Accoroni S, Totti C. The toxic benthic dinoflagellates of the genus Ostreopsis in temperate areas: a review. Advances in Oceanography and Limnology. 2016;7(1):1-15.
- Aligizaki K, Katikou P, Nikolaidis G, Panou A. First episode of shellfish contamination by palytoxin-like compounds from Ostreopsis species (Aegean Sea, Greece). Toxicon. 2008;51(3):418-427.
- Avancini M, Cicero AM, Di Girolamo I, Innamorati M, Magaletti E, Zunini TS. Guida al riconoscimento del plancton dei mari italiani. Vol. I Fitoplancton. Programma di monitoraggio per il controllo dell’ambiente marino costiero. Ministero dell’Ambiente e della Tutela del Territorio e del Mare. ICRAM. 2006.
- Bushati M, Koni E, Miho A, Bregaj M. Temporal distribution of potentially toxic algae (dinoflagellates and diatoms) in butrinti lagoon. Natura Montenegrina. 2010;9(3):307-319.
- Carnicer O, García-Altares M, Andree KB, Diogene J, Fernández-Tejedor M. First evidence of Ostreopsis cf. ovata in the eastern tropical Pacific Ocean, Ecuadorian coast. Botanica Marina. 2016;59(4):267-274.
- Casabianca S, Casabianca A, Riobó P, Franco JM, Vila M, Penna A. Quantification of the toxic dinoflagellate Ostreopsis spp. by qPCR assay in marine aerosol. Journal of Environmental Science and Technology. 2013;47(8):3788-3795.
- Ciminiello P, Dell’Aversano C, Dello Iacovo E, Fattorusso E, Forino M, Tartaglione L, et al. First finding of Ostreopsis cf. Ovata toxins in marine Aerosols. Environmental Science & Technology. 2014;48(6):3532-3540.
- Ciminiello P, Dell’Aversano C, Dello Iacovo E, Fattorusso E, Forino M, Tartaglione L, et al. Unique toxin profile of a Mediterranean Ostreopsis cf. ovata Strain: HR LC-MS(n) characterization of Ovatoxin-f, a new palytoxin congener. Chemical Research in Toxicology. 2012;25(6):1243-1252.
- Doyle JJ, Doyle JL. A rapid DNA isolation procedure from small quantities of fresh leaf tissue. Phytochemical Analysis. 1987;19:11-15.
- Faust MA, Morton SL, Quod JP. Further SEM study of marine dinoflagellates: The genus Ostreopsis (Dinophyceae). Journal of Phycology. 1996;32(6):1053-1065.
- Ismael A, Halim Y. Potentially harmful Ostreopsis spp. in the coastal waters of Alexandria–Egypt. Mediterranean Marine Science. 2012;13(2):208-212.
- ISPRA, Quaderni - Ricerca Marina n. 5/2012. Monitoraggio di Ostreopsis ovata e Ostreopsis spp.: protocolli operativi. ISBN 978-88-448-05586.
- Monti M, Minocci M, Beran A, Ivesa L. First record of Ostreopsis cfr. Ovata on macroalgae in the Northern Adriatic Sea. Marine Pollution Bulletin. 2007;54(5):598-601.
- Nascimento SM, França JV, Gonçalves JEA, Ferreira CEL. Ostreopsis cf. ovata (Dinophyta) bloom in an equatorial island of the Atlantic Ocean. Marine Pollution Bulletin. 2012;64(5):1074-1078.
- Penna A, Battocchi C, Capellacci S, Fraga S, Aligizaki K, Lemée R, et al. Mitochondrial, but not rDNA, genes fail to discriminate dinoflagellate species in the genus Ostreopsis. Harmful Algae. 2014;40:40-50.
- Penna A, Vila M, Fraga S, Giacobbe MG, Andreoni F, Riobó P, et al. Characterization of Ostreopsis and Coolia (Dinophyceae) isolates in the western Mediterranean Sea based on morphology, toxicity and internal transcribed spacer 5.8s rDNA sequences. Journal of Phycology. 2005;41(1):212-225.
- Penna A, Fraga S, Battocchi C, Casabianca S, Riobò P, Giacobbe MG, et al. A phylogeographical study of the toxic benthic dinoflagellate genus Ostreopsis Schmidt. Journal of Biogeography. 2010;37(5):830-841.
- Pfannkuchen M, Godrijan J, Marić Pfannkuchen D, Iveša L, Kružic P, Ciminiello P, et al. Toxin-producing Ostreopsis cf. ovata are likely to bloom undetected along coastal areas. Environmental Science & Technology. 2012;46(10):5574-5582.
- Sechet V, Sibat M, Chomérat N, Nézan E, Grossel H, Lehebel-Peron JB, et al. Ostreopsis cf. ovata in the French Mediterranean coast: molecular characterization and toxin profile. Cryptogamie, Algologie. 2012;33(2):89-98.
- Shears NT, Ross PM. Blooms of benthic dinoflagellates of the genus Ostreopsis; an increasing and ecologically important phenomenon on temperate reefs in New Zealand and worldwide. Harmful Algae. 2009;8(6):916-925.
- Hasle GR, Syvertsen EE, Steidinger KA, Tangen K. Dinoflagellates. In: Tomas CR (Ed), Identifying Marine Diatoms and Dinoflagellates, Academic Press, New York. 1996:387-598.
- Totti C, Accoroni S, Cerino F, Cucchiari E, Romagnoli T. Ostreopsis ovata bloom along the Conero Riviera (northern Adriatic Sea): relationships with environmental conditions and substrata. Harmful Algae. 2010;9(2):233-239.
- CSN EN 15204 - Water quality - Guidance standard on the enumeration of phytoplankton using inverted microscope – Utermöhl technique. 2006.
- Utermohl H. Zur Vervollkommnung der quantitativen Phytoplankton-Methodik: Mitt. 1958.
- Vila M, Arin L, Battocchi C, Bravo I, Fraga S, Penna A, et al. Management of Ostreopsis blooms in recreational waters along the Catalan coast (NW Mediterranean Sea): cooperation between a research project and a monitoring program. Cryptogamie Algologie. 2012;33(2):143-152.



