Research Article
Open Access
Alpha 1 Acid Glycoprotein: Increased Serum and
Localized mRNA Expression as a Monitor for
Reactions in Leprosy
Astha Nigam, Itu Singh, Ravindra P. Turankar, Mallika Lavania and Utpal Sengupta
Stanley Browne Laboratory, The Leprosy Mission Trust India, New Delhi, India
*Corresponding author: Utpal Sengupta, Stanley Browne Laboratory, The Leprosy Mission Trust India, New Delhi, India. Pin-110093, Tel: +91-112-259-4295; E-mail:
@
Received: May 01, 2015; Accepted: July 13, 2015; Published: August 17, 2015
Citation: Nigam A, Singh I, Turankar RP, Lavania M, Sengupta U (2015) Alpha 1 Acid Glycoprotein: Increased Serum and Localized
mRNA Expression as a Monitor for Reactions in Leprosy. SOJ Microbiol Infect Dis 3(3): 1-4. DOI: http://dx.doi.org/10.15226/sojmid/3/3/00137
Abstract Top
Alpha 1 Acid Glycoprotein (AGP) has been identified as a potentially
useful marker of clinical outcome in disease having inflammatory
component. The objective of this study is to determine the
levels of AGP with the possibility of using as a biomarker for Type 1
reactions (T1R) and Type 2 reactions (T2R) in leprosy. Serum levels
of AGP are evaluated in a total of 88 leprosy subjects [T1R; n = 32,
T2R; n =17 and Non-Reactional (NR); n = 39] using an Enzyme Linked
Immunosorbent Assay (ELISA). Relative quantification of mRNA encoding
AGP is also done from skin biopsies of same patients using
Real time PCR. The results revealed that the levels of serum AGP are
significantly higher in all leprosy cases with T1R and T2R when compared
to NR leprosy cases across the study groups (p < 0.05). The
Cross sectional analysis also revealed that the levels of mRNA expression
of AGP are significantly higher (p < 0.05) in leprosy cases with
both reactions when compared to non-reaction leprosy Cases (p <
0.05). Comparisons are made using Kruskal Wallis non parametric
Test. Significantly higher levels of AGP in serum and in the lesions of
patients may indicate its role as a predictive biomarker for type 1 and
2 reactions in leprosy.
Keywords: Alpha 1 Acid Glycoprotein; Biomarker; Leprosy; Type 1 Reaction; Type 2 Reaction
Keywords: Alpha 1 Acid Glycoprotein; Biomarker; Leprosy; Type 1 Reaction; Type 2 Reaction
Introduction
Acute inflammation is one of the most essential host
responses to tissue injury or infection for the defense and
eventual restoration of tissue structure and function. Prolonged
inflammation, however, can contribute to the pathogenesis of
many diseases leading to loss of the function of tissue or organ
which often occurs in leprosy. Leprosy is a chronic infectious
disease caused by Mycobacterium leprae (M. leprae). M. leprae
mainly resides in macrophages of skin and Schwann cells of
peripheral nerves leading to neuropathy and loss of sensation
in the extremities of the body and in the area involved in the
skin. It is a spectral disease ranging from tuberculoid pole to
lepromatous pole with intermediate borderline forms.
Individuals with borderline disease Borderline Tuberculoid (BT), borderline borderline/mid borderline (BB) and Borderline Lepromatous (BL) experience T1R and T2R. T1R is an immunologically mediated episode that is a major cause of nerve function impairment. Nerve function impairment may result in disability and deformity [1]. T2R occurs in Multibacillary (MB) patients (Lepromatous leprosy (LL) and BL) [2]. T2R mainly occurs because of deposition of M. leprae antigen-antibody complexes in tissues, which leads to complement activation and neutrophil infiltration resulting in systemic inflammatory response. Both the reactions are mainly responsible for nerve damage that causes permanent disability in leprosy patients.
AGP, also called orosomucoid, are acute-phase protein that can increase in plasma as much as 5-fold [3] in inflammation during acute and chronic infections.AGP is a 43kDa protein that is highly glycosylated [4]. Due to the presence of sialic acids, AGP is very negatively charged, its pi being only 2.7 [5]. AGP is produced mainly in the liver [6] although some extra-hepatic synthesis of this protein has also been reported [7, 8]. The basal level of AGP in serum is maintained at approximately 20 μmol/L in healthy individuals. During an acute phase condition, the concentration rises 2–5 times, making it one of the predominant proteins in serum. Although AGP is an abundant protein, its real physiological significance is not yet fully understood. Protective effects of AGP against TNF-α induced pathogenesis have been described In vivo [9] and gives non-specific resistance against lethal gram negative infection [10]. Keeping in mind both anti-inflammatory as well as pro-inflammatory property of AGP [11,12] we designed the present study. In the past, there has been one study indicated high level of AGP in T2R [13] and showed its association with T2R as a biomarker and an indicator of cure during treatment.
It is important that if manifestations of reactions in leprosy are recognized early, then it would be possible for early intervention with protective medicine like steroids and save the nerve and tissue from the damage [14].We, therefore in this study, attempt to examine the role of this protein in the development of both type 1 and 2 reactions in leprosy.
Individuals with borderline disease Borderline Tuberculoid (BT), borderline borderline/mid borderline (BB) and Borderline Lepromatous (BL) experience T1R and T2R. T1R is an immunologically mediated episode that is a major cause of nerve function impairment. Nerve function impairment may result in disability and deformity [1]. T2R occurs in Multibacillary (MB) patients (Lepromatous leprosy (LL) and BL) [2]. T2R mainly occurs because of deposition of M. leprae antigen-antibody complexes in tissues, which leads to complement activation and neutrophil infiltration resulting in systemic inflammatory response. Both the reactions are mainly responsible for nerve damage that causes permanent disability in leprosy patients.
AGP, also called orosomucoid, are acute-phase protein that can increase in plasma as much as 5-fold [3] in inflammation during acute and chronic infections.AGP is a 43kDa protein that is highly glycosylated [4]. Due to the presence of sialic acids, AGP is very negatively charged, its pi being only 2.7 [5]. AGP is produced mainly in the liver [6] although some extra-hepatic synthesis of this protein has also been reported [7, 8]. The basal level of AGP in serum is maintained at approximately 20 μmol/L in healthy individuals. During an acute phase condition, the concentration rises 2–5 times, making it one of the predominant proteins in serum. Although AGP is an abundant protein, its real physiological significance is not yet fully understood. Protective effects of AGP against TNF-α induced pathogenesis have been described In vivo [9] and gives non-specific resistance against lethal gram negative infection [10]. Keeping in mind both anti-inflammatory as well as pro-inflammatory property of AGP [11,12] we designed the present study. In the past, there has been one study indicated high level of AGP in T2R [13] and showed its association with T2R as a biomarker and an indicator of cure during treatment.
It is important that if manifestations of reactions in leprosy are recognized early, then it would be possible for early intervention with protective medicine like steroids and save the nerve and tissue from the damage [14].We, therefore in this study, attempt to examine the role of this protein in the development of both type 1 and 2 reactions in leprosy.
Methods
Study subjects
Eighty eight newly diagnosed untreated leprosy patients with no reaction (NR) (n = 39) and with reactions (n =49; T1R =
32, T2R = 17) (ages between 10 and 60 years) were recruited
at TLM Community Hospital, New Delhi, India. All cases were
clinically examined by experienced dermatologists and were
classified on the histological scale of Ridley-Jopling (RJ) [15] from
biopsy specimens.
ELISA for AGP measurement: Serum was separated from 5ml of venous blood followed by addition of protease inhibitor cocktail (Sigma Aldrich Inc.) and stored at −200C until further processing. Levels of AGP in serum samples were detected in triplicate employing commercial ELISA kit (R&D System Inc. USA) following the manufacturer's instructions.
RNA extraction, cDNA synthesis and quantitative PCR: 5×5 mm incisional skin biopsies taken from the edge of the lesions were collected in RNA later for RNA extraction by using TRI-reagent (Sigma–Aldrich) according to the manufacturer's instructions. The concentration of RNA samples were determined spectrophotometrically at 260/280nm. cDNA was constructed from 1 μg of total RNA from each sample using Protoscript® M-MuLV First Strand cDNA Synthesis Kit (New England Biolabs Inc). Briefly, 1 μg of total RNA was mixed with Random Primer mix and nuclease free water. RNA was then denatured at 700 C for 5 min. This is followed by the addition of Reaction Mix containing buffer, Magnesium ions, dNTPs and Enzyme Mix containing 0.5 units/μl of Reverse Transcriptase and RNase Inhibitor. Temperature cycling conditions included 25° C for 5 min, 45° C for 1 h followed by inactivation of enzyme at 80°C for 5 min.
Two microliters of cDNA was used per 20 μl reaction. The reaction was carried out using the SYBR Green PCR Master Mix on Rotor Gene Q (Qiagen Inc. USA) using gene specific primer set designed for this study (Table 1). Each experiment was performed in duplicate.
ELISA for AGP measurement: Serum was separated from 5ml of venous blood followed by addition of protease inhibitor cocktail (Sigma Aldrich Inc.) and stored at −200C until further processing. Levels of AGP in serum samples were detected in triplicate employing commercial ELISA kit (R&D System Inc. USA) following the manufacturer's instructions.
RNA extraction, cDNA synthesis and quantitative PCR: 5×5 mm incisional skin biopsies taken from the edge of the lesions were collected in RNA later for RNA extraction by using TRI-reagent (Sigma–Aldrich) according to the manufacturer's instructions. The concentration of RNA samples were determined spectrophotometrically at 260/280nm. cDNA was constructed from 1 μg of total RNA from each sample using Protoscript® M-MuLV First Strand cDNA Synthesis Kit (New England Biolabs Inc). Briefly, 1 μg of total RNA was mixed with Random Primer mix and nuclease free water. RNA was then denatured at 700 C for 5 min. This is followed by the addition of Reaction Mix containing buffer, Magnesium ions, dNTPs and Enzyme Mix containing 0.5 units/μl of Reverse Transcriptase and RNase Inhibitor. Temperature cycling conditions included 25° C for 5 min, 45° C for 1 h followed by inactivation of enzyme at 80°C for 5 min.
Two microliters of cDNA was used per 20 μl reaction. The reaction was carried out using the SYBR Green PCR Master Mix on Rotor Gene Q (Qiagen Inc. USA) using gene specific primer set designed for this study (Table 1). Each experiment was performed in duplicate.
Statistical analysis
The statistical analysis was performed using Graph-Pad
Prism software (Version 6). ANOVA was used to compare
means of clinical laboratory parameters. The Kruskal-Wallis
nonparametric test was used to test differences between
responses among three groups and post test (Dunn's test) was
applied to find out the significant difference between NR and
T1R/T2R group. All statistical analyses were two sided, and a p
value of < 0.05 was considered statistically significant. Graphs are
shown as mean ± Standard Error of Mean (SEM) by using Graph
pad prism, two sided table, n-1 degree of freedom, alpha=0.05,
95% Confidence Interval.
The real-time data were analyzed on Rotor-Gene Q Series Software (Software Version 2.0.2). An association with p value < 0.05 was considered as statistically significant.
The real-time data were analyzed on Rotor-Gene Q Series Software (Software Version 2.0.2). An association with p value < 0.05 was considered as statistically significant.
Results
Serum levels of AGP across the study groups
Analysis of AGP across the study groups reveal that the levels
are significantly higher in leprosy cases with T1R and T2R when
compared to that of NR group (T1R Vs NR mean± SEM= 464502 ±
26333 vs 231485 ± 22843, T2R Vs NR 450255 ± 41659vs231485
± 22843, p<0.05 (Figure 1)
Analysis of mRNA expression profiles of GAPDH and
AGP in the skin lesions
We analyzed mRNA expression profile by calculating fold
difference in expression using Pfaffl method (16) based on the
formula mentioned below:
The percentage efficiency of the primers from the standard
graphs was determined to be in the order of 98% for GAPDH
(Glyceraldehyde 3 Phosphate Dehydrogenase) (House Keeping
Gene) and 97% for AGP.
Individual expression ratio using the above formula was calculated for cases in T1R, T2R and NR leprosy taking the average ratio of NR as the control value for all the cases. Coincident measurement of GAPDH gene has been used for the normalization of target gene expression data.
Cross sectional analysis of mRNA expression levels of AGP across the study groups revealed that the levels are significantly higher in leprosy cases with T1R and T2R when compared to NR group (T1R Vs NR and T2R Vs NR, mean mRNA Expression Ratios ± SEM = 36.45 ± 19.61 Vs11.02 ± 4.817 and 64.49 ± 17.60 Vs 11.02 ± 4.817, p<0.001). Although no significant difference was found between T1R and T2R (Figure 2).
Individual expression ratio using the above formula was calculated for cases in T1R, T2R and NR leprosy taking the average ratio of NR as the control value for all the cases. Coincident measurement of GAPDH gene has been used for the normalization of target gene expression data.
Cross sectional analysis of mRNA expression levels of AGP across the study groups revealed that the levels are significantly higher in leprosy cases with T1R and T2R when compared to NR group (T1R Vs NR and T2R Vs NR, mean mRNA Expression Ratios ± SEM = 36.45 ± 19.61 Vs11.02 ± 4.817 and 64.49 ± 17.60 Vs 11.02 ± 4.817, p<0.001). Although no significant difference was found between T1R and T2R (Figure 2).
Discussion
In an attempt to identify a biomarker for detection of the
onset of reactions in leprosy we analyzed mRNA expression
profile and serum levels of AGP in leprosy patients with type 1
and type 2 reactions along with a control group of patients having
no reactions at the time of recruitment. We have identified a
statistically significantly high level of AGP in serum of both types
of leprosy reactions. The higher AGP levels as reflected in the
serum profile, in active reaction patients than in controls with
no reaction could be an early indication of disease progression.
AGP is an inflammation related protein. The several fold increase
of AGP concentration in the circulation during an acute phase
Table 1: Primer set for mRNA expression.
Gene |
Sequence |
Length of Amplicon |
GAPDH (Housekeeping gene) |
F-5'TTGGTATCGTGGAAGGACTCA-3' R-5'TGTCATCATATTTGGCAGGTTT-3' |
270 bp |
AGP (in house designed primers) |
F-5'CAAGTGACCGCCCATAGTTT3' R-5'GAAAGGCCGATGCGATATAA3' |
238 bp |
Figure 1: Levels of AGP in serum samples of NR (n =3 9), T1R (n = 32)
and T2R (n = 17) of leprosy patients using ELISA. (*** p < 0.0001)
Figure 2: mRNA expression ratios of AGP/GAPDH in lesional skin biopsies
of NR (n =39), T1R (n =32) and T2R (n =17) leprosy patients using
real time PCR. (** p < 0.001)
response could influence the biological functions of the molecule
in humans [3]. Although the detailed biological functions of AGP
have not been elucidated completely, the major physiological
roles of AGP reported so far involve the binding and transport
of a range of drugs and it has immunomodulating effects as
well [17]. This protein induces monocytes and macrophages to
synthesis pro-inflammatory cytokines IL-6, IL-12 and expression
of molecules that inhibit the activity of IL-1β and TNF-α by IL-1
receptor antagonist and soluble TNF receptor [18]. This cytokinepattern
suggests that AGP might have a dual effect; inducing
both a pro-inflammatory environment and an anti-inflammatory
environment, depending on the circumstances and the phase of
the disease [19]. Leprosy presents a spectrum of immunological
groups between the two poles, the tuberculoid pole (TT) with
increased cell mediated immunity, which gradients towards
the lepromatous pole (LL) through a series of borderline forms
(BT, BB and BL) with simultaneous increase in humoral immune
response and increase in the bacillary load. Type1 reaction
(T1R) also called Reversal Reaction (RR), particularly occurs
in BT through BL types of leprosy with exacerbations of the
pre-existing skin and nerve lesions due to up-gradation of Cell
Mediated Immunity (CMI) more often during and after Multi
Drug Therapy (MDT) [2]. Dynamics of immunological reactions could reflect by changes in the levels of certain circulatory
molecules that could act as possible biomarkers for predicting
reactions in leprosy (20). A Predictive biomarker for prediction
of inflammatory reactions in leprosy has long been desired. In
the present study, we have evaluated the diagnostic efficacy of
the AGP in T1R and T2R of leprosy that lead to nerve function
impairments in the patients. The present study focused on the
presence of AGP in circulation and lesions in reactional state
of leprosy. We here demonstrated, using ELISA and Real-Time
PCR analysis the presence of AGP, in serum and skin from
active lesions of patients with leprosy reactions including skin
smear negative BL and BT leprosy patients. Not only systemic
but localized levels of AGP measured in terms of relative gene
expression revealed that this acute phase protein coding gene
is over expressed in lesional skin mRNA which indicates its
active role in regulation of inflammatory episodes at the lesional
levels. Although,no significant difference in AGP production
was observed between T1R and T2R group. But when taken
together, these data suggest that AGP levels correlate with
reactional state in leprosy. However, this study has limitations
inherent to its cross-sectional design that cannot determine a
causal relationship. It may also be assumed that our sample size
is relatively small. More evidence is required to evaluate the
association between high levels of AGP, and reactional state of
leprosy. Since this study should be considered as preliminary,
the consistency of the association might be explored in other
clinical studies monitoring the common inflammatory mediators
(CRP, IL-6, TNF-α etc.), including AGP, in leprosy patients with
T1R, T2R and in patients without any reaction as controls. The
present study has several strengths. It is the first study to deal
with the association between clinical parameters and T1R, T2R
in a leprosy population. We chose untreated leprosy patients
with T1R and T2R as a model because it represents the exact
role of AGP, in developing the inflammatory condition. To
our knowledge, this is the first clinical study demonstrating a
systemic link between AGP and inflammation in leprosy using
real-time expression for localized along with serum circulatory
levels. A prospective cohort study involving measurement of AGP
levels, before, during and after the occurrence of T1R, T2R and
during MDT treatment may provide predictive information on
the effectiveness of AGP as a biomarker to identify patients going
to manifest reactions in leprosy.
Conclusion
Acute-phase proteins produced by cytokine activity are useful
diagnostic markers that could also be used to monitor treatment
response as they can be serially quantified and used as regression
markers of the inflammatory response during treatment the
quantification of proteins during the course of various acute and
chronic inflammatory disorders is useful in diagnosis, therapy,
and in some cases, prognosis. The AGP is measurable biomarker
that correlates reactions in leprosy and may be indicative factor
of conditions favorable to nerve damage, as it shows a significant
increase in type 1and 2 reactions both in terms of levels in serum
and also in their mRNA expression. The conclusions of our study
support the hypothesis that localized, persistent infection may
influence systemic levels of inflammatory mediators. However, larger prospective studies are needed to establish its utility as
a biomarker that may be predictive factor of clinical outcome in
the population.
Acknowledgement
This study was part of Project ID No: 2010-12950 granted
from the "Indian Council of Medical Research-New Delhi". We
extend our special thanks to all the participants who volunteered
for the study. We would like to thank The Leprosy Mission (TLM)
Trust India, the host organization, and the entire associated
medical staff. The authors declare that they have no conflict of
interest. The authors alone are responsible for the content and
writing of the paper. This study was approved by the Ethical
Committee of The Leprosy Mission Trust India (TLMTI) and
written informed consent was obtained from all patients and
control subjects.
ReferencesTop
- Stefani MM, Guerra JG, Sousa AL, Costa MB, Oliver ML, Martelli CT, et al. Potential plasma markers of Type 1 and Type 2 leprosy reactions: a preliminary report. BMC Infect Dis. 2009; 9:75. doi: 10.1186/1471- 2334-9-75.
- Kahawita IP, Walker SL, Lockwood DNJ. Leprosy type 1 reactions and erythema nodosum leprosum. An Bras Dermatol. 2008;83(1):75-82.
- Kremer JM, Wilting J, Janssen LH. Drug binding to human alpha-1-acid glycoprotein in health and disease. Pharmacol Rev. 1988; 40(1):1-47.
- Kushner I. The acute phase response: an overview. In: Mackiewicz, A, Kushner I, Baumann H, editors. Acute phase proteins: molecular biology, biochemistry, and clinical applications. Boca Raton: CRC Press;1993. p. 3–19.
- Schmid K. Alpha 1-Acid glycoprotein. In: Putman FW, editor. The plasma proteins: structure function and genetic control. New York: Academic Press;1975:183–92.
- Gahmberg CG, Andersson LC. Leukocyte surface origin of human alpha1-acid glycoprotein (orosomucoid). J Exp Med. 1978; 148(2):507-521.
- Eap CB, Baumann P, Moretta A. Synthesis of Alpha 1-acid glycoprotein by human T lymphocytes. Experientia. 1989;45:A 52.
- Sörensson J, Matejka GL, Ohlson M, Haraldsson B. Human endothelial cells produce orosomucoid, an important component of the capillary barrier. Am J Physiol. 1999;276(2 Pt 2):H530-4.
- Libert C, Brouckaert P, Fiers W. Protection by alpha 1-acid glycoprotein against tumor necrosis factor-induced lethality. J. Exp. Med. 1994;180(4):1571–5.
- Hochepied T, Van Molle W, Berger FG, H Baumann, C Libert. Involvement of the acute phase protein α1-acid glycoprotein in nonspecific resistance to a lethal Gram-negative infection. J. Biol. Chem.2000;275:14903–9.
- Boutten A, Dehoux M, Deschenes M, Rouzeau JD, Bories PN, Durand G. Alpha 1-Acid glycoprotein potentiates lipopolysaccharide-induced secretion of interleukin-1beta, interleukin-6 and tumor necrosis factor-alpha by human monocytes and alveolar and peritoneal macrophages. Eur.J.Immunol. 1992;22(10):2687–95.
- Su SJ, Yang BC, Wang YS, Yeh TM. Alpha1-Acid glycoprotein-induced tumor necrosis factor-a secretion of human monocytes is enhanced by serum binding proteins and depends on protein tyrosine kinase activation. Immunopharmacology. 1999;41(1):21-9.
- Gupta N1, Shankernarayan NP, Dharmalingam K.. Alpha 1-Acid glycoprotein as a putative biomarker for monitoring the development of the type II reactional stage of leprosy. J Med Microbiol. 2010;59(Pt 4):400-7. doi: 10.1099/jmm.0.016394-
- Lockwood DN, Suneetha S. Leprosy: too complex a disease for a simple elimination paradigm. Bull World Health Organ. 2005;83(3):230-5.
- 15. Ridley DS, Jopling WH. Classification of leprosy according to immunity: a five group system. Int J Lepr Other Mycobact Dis. 1966;34(3):255-73.
- Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29(9):e45.
- Fournier T, Medjoubi N N, Porquet D. Alpha 1 acid glycoprotein. Biochim. Biophys. Acta 2000;1482(1-2):157-71.
- Tilg H, Vannier E, Vachino G, Dinarello CA, Mier JW. Antiinflammatory properties of hepatic acute phase proteins: preferential induction of interleukin 1 (IL-1) receptor antagonist over IL-1 beta synthesis by human peripheral blood mononuclear cells. J. Exp. Med. 1993;178(5):1629–36.
- Hochepied T, Berger FG, Baumann H, Libert C. Alpha(1)-Acid glycoprotein: an acute phase protein with inflammatory and immunomodulating properties. Cytokine Growth Factor Rev. 2003;14(1):25-34.
- Scollard DM, Smith T, Bhoopat L, Theetranont C, Rangdaeng S, Morens DM. Epidemiologic characteristics of leprosy reactions. Int J Lepr Other Mycobact Dis. 1994;62(4):559-67.




