Research Article
Open Access
Exopolyphosphatase of Lysinibacillus sphaericus
is Essential for Stresses Resistance and
Production of Binary Toxins
Tingyu Shi1,2, Xinggao Dong1, Yimin Hu2, Xiaomin Hu2, Zhiming Yuan2*
1Department of Basic Medicine, Medical School of Hubei Institute for Nationalities, Enshi 445000, People's Republic of China
2Key Laboratory of Agricultural and Environmental Microbiology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, People's
Republic of China
*Corresponding author: Zhiming Yuan, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China, Tel: +86 27 87198195;
Fax: + 86 27 87199480; E-mail:
@
Received: April 08, 2016; Accepted: May 04, 2016; Published: May 07, 2016
Citation: Shi T, Dong X, Hu Y, Hu X, Yuan Z (2016) Exopolyphosphatase of
Lysinibacillus sphaericus is Essential for Stresses Resistance
and Production of Binary Toxins. SOJ Microbiol Infect Dis 4(2): 1-6. DOI:
http://dx.doi.org/10.15226/sojmid/4/2/00145
The Exopolyphosphatase (PPX) of Lysinibacillus sphaericus is
encoded by the Bsph_1303 gene (ppx), being responsible for the
hydrolysis of inorganic polyphosphates to orthophosphate (Pi). In
the present work, we identified and characterized the ppx from L.
sphaericus. We found that ppx disruption resulted in massive polyP
accumulation, compromised the resistance to high osmotic, high
pH and high temperature, and impaired the motility and biofilm
formation. Additionally, results obtained from the ppx null mutant
demonstrated that PPX was involved in the production of binary
toxins and growth in MBS medium, a medium for toxicity production.
These result indicated that PPX of L. sphaericus appeared to be
essential for the resistance to stresses and binary toxins production.
Keywords: Polyphosphate; Binary toxins; Lysinibacillus
sphaericus; Exopolyphosphatase
Abbreviations
PolyP: Polyphosphate; PPX: Exopolyphosphatase
Introduction
Inorganic Polyphosphates (polyPs) are linear polymers
consisting of tens to hundreds of Orthophosphate (Pi) residues
linked by energy-rich phosphoanhydride bonds. Numerous
investigations indicate that polyP is essential for the growth
of microorganisms, their responses to various environmental
stresses, and the virulence of pathogens [1]. PolyP is synthesized
by Polyphosphate Kinase (PPK) that catalyses the reversible
transfer of terminal phosphate of ATP to polyP chain [2]. PolyP
can be degraded by the Exopolyphosphatase (PPX) that releases
Pi processively from the termini of the polyP chain [3].
Although polyP has been shown to have important functions
in many microorganisms, there are few studies on the role of this
polymer in Bacillus. Feasible reason is that the important model
organism, Bacillus subtilis does not harbor the ppk gene [1]. The
first study about polyP in Bacillus cereus demonstrated that
polyp is involved in motility, biofilm formation, and sporulation [4]. Other investigations reported that the exogenous longchain
polyP inhibited the cereulide toxin synthesis [5] and
septum formation, and caused cell lysis [6]. Additionally, in
Bacillus thuringiensis, overexpression of ppk gene increases
bioinsecticide production [7].
L. sphaericus is mesophilic, aerobic rod-shaped bacteria, and
some of them produce parasporal crystal proteins specifically
toxic to Culex and Anopheles mosquito larvae and have been
widely used as biocontrol agents. The larvicidal activity of L.
sphaericus is mainly due to the production of two crystalline
mosquito-larvicidal proteins of 42 kDa (BinA) and 51 kDa (BinB)
during sporulation [8,9]. L. sphaericus is considered one of the
most successful microbial larvicide and has been commercialized
over the past decade [10]. Besides the binary toxins, some other
toxins such as sphaericolysin, vegetative mosquitocidal toxins,
Cry48/ Cry49 toxin are also responsible for its larvicidal activity
[10]. To date, the mechanism by which Bin kills mosquito larvae
remains largely unsolved. One hypothesis is that pore formation
by binary toxins may be sensed by p38 mitogen-activated
protein kinase, whose activity might induce autophagy [10,11].
Moreover, to our knowledge there was nearly no study on
resistance of L. sphaericus to environmental stresses, which was
essential for its recycling in mosquito breeding sites. Recently,
we identified the ppk gene of L. sphaericus C3-41 and found
that ppk gene affected polyP accumulation and bacterial growth
[12]. Various stresses were encountered when L. sphaericus
accessed to the haemocoel of mosquito and recycled in mosquito
cadaver [13,14]. So, responses to all stresses were essential for
growth and toxin production of L. sphaericus. Recent genetic
and molecular analyses have revealed how several strategies
enable bacteria to persist and overcome host immune defences
[15]. PolyP is essential for growth, survival and the virulence of
pathogens [1,16].
Here, we have provided evidence that PPX of L. sphaericus
is required for stress resistance such as osmotic pressure, high
pH value and high temperature, and for motility and biofilm formation. We also demonstrated that binary toxins production
is affected by PPX.
Materials and Methods
Bacterial strains and plasmids
The bacterial strains and plasmids used for this study are
listed in Table 1. Escherichia coli DH5α and BL21 (DE3) were
used as hosts for cloning and expression, respectively. The ppx
was amplified from L. sphaericus C3-41 genomic DNA with the
primer pairs: Fppx and Rppx. The PCR product was excised and
cloned between the BamHI/SacI sites of pET28a+ to generate the
plasmid pET28a-BsPPX.
Null mutant allele of ppx was obtained by using a two-step
PCR strategy [12]. The resulting plasmid for allelic displacement and reverse mutation of ppx were named as pNR5101-PPX and
pHT304-ppx, respectively. The primers were listed in Table 2.
Media and growth conditions
Unless otherwise specified, E. coli strain was grown at 37°C
in Luria-Bertani (LB) medium. L. sphaericus were grown at 30°C
in LB or MBS medium (pH 7.4) [17]. Antibiotics were added to
growth media at the following final concentrations: Ampicillin
(100 μg/ ml), Erythromycin (20 μg/ ml), Kanamycin (50 μg/ ml
for E. coli, 10 μg/ ml for L. sphaericus) and tetracycline (10 μg/
ml). For solid medium, agar was added to a final concentration
of 1.5% (w/ v).
Cloning and expression of ppx genes
Recombinant plasmid pET28a-PPX was transformed into E.coli
Table 1: Strains and plasmids used for this study.
Strains or plasmids |
Characteristics |
Source or reference |
Escherichia coli |
|
|
JM109 |
Cloning host |
Lab stock |
BL21(DE3) |
Expression host |
Lab stock |
B. sphaericus |
|
|
C3-41 |
Wild type strain bearing native pBsph plasmid |
Lab stock |
∆ppx |
C3-41 mutant with deletion of the ppx gene |
This study |
∆ppx (pHT304-ppx) |
∆ppx with plamid pHT304-ppx |
This study |
Plasmids |
|
|
pET28a |
Expression vector in E. coli |
Lab stock |
pET28a-PPX |
pET28a with ppx gene |
This study |
pRN5101 |
Recombinant vector used in gene disruption experiments, Ampr, Ermr |
[26] |
pRN5101-PPX |
pRN5101 carrying partial ppx deletion gene |
This study |
pHT304 |
Plasmid designed for gene expression in Bacillus. |
[27] |
pHT304-spc |
pHT304 with spc promoter region |
This study |
pHT304-ppx |
pHT304 with ppx gene fused to the downstream of spc promoter region |
This study |
pMarC333 |
Source of the spectinomycin promoter region |
[28] |
Table 2: Oligonucleotide primers designed to generate DNA fragment for plasmid construction.
Primers |
Sequences (5' to 3') |
Restriction sites |
Primers used in plasmid construction |
|
Fppx |
CGCGGATCCATGCTTGAAGGATGTGATTATC |
BamHI |
Rppx |
TA CGAGCTCGGCTCATTATTCGTTATTT |
SacI |
Fppx-up-ko |
ACGCGTCGACTGTTCCATGTGGATAACGTGACA |
SalI |
Rppx-up-ko |
GCCCCTCTTCATTGTTATACTGATA |
|
Fppx-down-ko |
AAGGATGGAATAAGGATGACAAC |
|
Rppx-down-ko |
CTAGCTAGCCCTCCAGTAGTACAACGACTGTT |
Nhe I |
Fkan-ppx |
TATCAGTATAACAATGAAGAGGGGCTAAACCCAGCGAACCA |
|
Rkan-ppx |
GTTGTCATCCTTATTCCATCCTTTCTAGGTACTAAAACA |
|
Fppx-up |
TGTGAACAAAATAAAC |
|
Rppx-up |
TGGTTCGCTGGGTTTA |
|
Fppx-down |
GTCATTGGGATTTTTA |
|
Rppx-down |
TGTTTTAGTACCTAGA |
|
Fppx-com |
CGCGGATCCATGCTTGAAGGATGTGATTATC |
BamHI |
Rppx-com |
TA CGAGCTCGGCTCATTATTCGTTATTT |
SacI |
Fspc-promoter |
CCCAAGCTTAGAGTTGGTAGCTCTTGATCC |
HindIII |
Rspc-promoter |
CGCGGATCCGATTTCACCTCGTTGATTATGT |
BamHI |
Restriction sites engineered into the primers are shown in underlined letters.
BL21 (DE3). Cells were grown at 37°C to an OD600 of 0.6.
For expression of PPX, IPTG was added to a final concentration
of 0.1 mM and growth was continued for 16h at 20°C. Cells were
harvested, re-suspended in 10 mM Tris-HCl (pH 7.5) with 1 mM
MgCl2, 1 mM PMSF and disrupted by sonication. Recombinant
and His6-tagged PPX was purified from the cell-free supernatant
by chromatography on Ni2+-NTA agarose.
PPX activity assay
The activity of PPX was measured by the detection of Pi
product [3]. Briefly, the reaction mixture (100 μL) contained
50 mM Tricine/ KOH (pH 8.0), 1 mM MgCl2, 175 mM KCl, 22 μg
PPX, and polyP as indicated (provided kindly by Shinichi Kato
[Regene Tiss Inc.]). MgCl2 was added last to avoid precipitation of
the polyP. The Pi generated by PPX was continuously assayed for
45 min using Molecular Probes' EnzChek® Phosphate Assay Kit
according to the manufacturer's protocol. One unit of enzyme is
defined as the amount releasing 1pmol of phosphate from polyP
per min.
Construction of ppx mutants pNR5101-PPX plasmid for
knockout of ppx genes was transformed into L. sphaericus C3-41
by electroporation [12]. The resulting mutation of ppx gene was
named as Δppx and the reverse mutation of ppx gene was named
as ΔppxC. All primers for knockout and validation of Δppx and
construction reverse mutation of ppx were presented in Table 2.
Extraction and quantification of polyP
The PolyP was extracted from L. sphaericus cells with Glass
milk as described previously [18]. Briefly, 2 ml of L. sphaericus
WT, Δppx and ΔppxC cultures at time points indicated were
pelleted in a 1.5 ml tube for 2 min, respectively. To the pellet
were added 0.5 ml of 4 M Guanidine Isothiocyanate (GITC)-50
mM Tris-HCl, pH 7.0 (GITC lysis buffer) and sonicated briefly; a
10 μL sample was removed for protein estimation. To each tube
were added 30 μL of 10% sodium dodecyl sulphate, 0.5 ml of 95%
ethanol, and 5 μL of Glass milk (Bio 101). After being centrifuged
briefly, the pellet was then suspended in 0.5 ml of cold New Wash
buffer (5 mM Tris-HCl [pH 7.5], 50 mM NaCl, 5mM EDTA and 50%
ethanol). The washed pellet was then resuspended in 50 μL of 50
mM Tris-HCl (pH 7.4)-10 mM MgCl2-20 μg each of DNase I and
RNase A per ml and incubated at 37°C for 10 min to remove DNA
and RNA. The pellet was washed first with 150 μL of 4 M GITC
lysis buffer and 150 μL of 95% ethanol, and then twice in New
Wash buffer. PolyP was eluted from the pellet with 50 μL of 50
mM Tris-HCl (pH 8.0) at 95°C for 2 min.
The amount of PolyP in L. sphaericus cells was quantitated
as described previously [12]. The amount of polyP in L.
sphaericus cells was measured based on the character that
polyp can be transformed to ATP by PPK reverse activity. The
ATP concentration was assayed with Bioluminescence Assay Kit
CLSII (Roche), and concentration of polyp is given in terms of Pi
residues.
Resistance to stress conditions
The resistance to stress conditions of wild type, Δppx and
ΔppxC were performed as described [19]. To test resistance to oxidative stress, 100 μL overnight cultures were spread on LB
agar medium in 90-mm-diameter Petri dishes. Subsequently,
3 MM filter paper disc (5 mm in diameter) containing 5μl of a
solution of 50 mM menadione (sigma) were layered on the plates.
After 2 days of incubation at 30°C, the halos of growth inhibition
were measured.
Biofilm and motility assays
Biofilm formation and motility assays were performed as
described [4,20].
Western blot analysis
L. sphaericus cultures were grown in MBS medium at 30°C.
Cells were harvested at indicated times and washed twice with
sterile water and then centrifuged. The soluble proteins were
electrophoresed in 12% SDS-PAGE gels and subsequently
transferred to PVDF membranes. After blocking, the membranes
were incubated for 2 hours with primary antibody (anti-BinA,
1:3000 and anti-BinB 1:1000) followed by incubation with
goat anti-mice HRP (horseradish peroxidase, 1:3000 dilution)
secondary antibody (Millipore). Finally, membranes were
developed using the luminal (ECL; Amersham Biosciences).
Bioassays
The toxicities of L. sphaericus C3-41, Δppx and ΔppxC against
fourth instar larvae of a susceptible Culex quinquefasciatus colony
were assayed by bioassay, performed as described by Yang et al.
[21]. Lethal concentrations of 50% and 90% were determined
by probit analysis with a program indicating mean and Standard
Error (SE).
Statistical analysis
Results are indicated as means and the standard deviation
(n = 3-8). The significances of the difference of the means in
experiments carried out with wild type, Δppx and ΔppxC were
calculated using a Student t text.
Results
Expression of ppx and activity assays
The gene encoding putative counterparts of PPX has been
identified in L. sphaericus (Bsph_1303). The putative PPX of
L. sphaericus C3-41 was of 524 amino acid residues, with a
calculated molecular masses of 57.64 kDa, and 44% identical
to those of B. cereus E33L. The gene products were expressed
as N-terminal His-tagged proteins in E. coli and purified by
affinity chromatography on Ni2+-NTA agarose (Figure 1A). As
shown in Figure 1B, recombinant PPX demonstrated polyP type-dependent
activity. The polyP14, polyP60 and polyP130 were
hydrolyzed by PPX with a specific activity of 6.48 × 103, 6.83
× 103 and 14.24 × 103 units/ mg protein, respectively (Figure
1D). Furthermore, recombinant protein PPX also demonstrated a
polyP concentration-dependent activity (Figure 1C), hydrolyzing
3 μm polyP130 and 10 μm polyP130 with specific activity of 6.75
× 103 and 23.3 × 103 units/ mg protein, respectively (Figure 1D).
These results confirmed the function of PPX in polyP metabolism.

Figure 1: Enzymatic activity of PPX. (A) SDS-PAGE of purified PPX. Lane 1: standard protein marker; lane 2: purified PPX; (B) Time course of different
length polyP (5 μm) degradation by PPX (22 μg); (C) Time course of different concentration polyP130 degradation by PPX (22 μg); (D) The specific
activity of PPX when hydrolyzing different polyP length and concentration. The specific activity of PPX was measured according to (B) and (C).
Inactivation of ppx resulting in polyP accumulation
In order to prove the effect of the ppx gene on accumulation
of polyP, the Δppx was obtained by homologous recombination.
As shown in Figure 2, there was significantly more abundant
polyP in Δppx compared with that in WT and the polyP levels in
Δppx were reduced significantly by expressing ppx gene.
Effect of a mutation in ppx on the resistance to stresses
in L. sphaericus
L. sphaericus C3-41 WT and the Δppx were grown in LB
medium under different conditions (high salt, high temperature,
low pH, or high pH) in order to evaluate their ability to grow under
stress conditions (Figure 3). Growth under no stress conditions
(LB medium) was not affected by PPX disruption (Figure 3A). The
extent of the effect of the Δppx varied under the different stress
conditions. The effect of PPX disruption seems different with
stress. High salt seems little effect on initial growth rate but final
OD. High pH seems to affect initial growth rate. High temperature
seems not affect growing rate but decrease of OD seems earlier in
Δppx mutant (Figure 3B, C and D). The defect could be partially
restored by plasmid expression of ppx in the mutant strain.
Growth in the presence of menadione (a superoxide radical
generator) was not affected by the Δppx under our experimental
conditions (data not shown).
Additionally, the biofilm formation and swimming on
semisolid agarose plates of mutants were dramatically decreased
(Figure 4). It is clear that the decrease was not attributable to the
impairment of growth, because the growth rates of mutants were
indistinguishable from that of WT in LB medium (Figure 3A).
Binary toxins production by mutant and control
strains
Growth of Δppx was impaired compared with WT when grown
in MBS medium (Figure 5A), a medium for toxicity production
[17]. In order to compare binary toxins production by Δppx with
that by WT, we analyzed protein levels of binary toxins in the
bacterial cells with the same wet-weight through SDS-PAGE and
Figure 2: Measurement of polyP extracted from L. sphaericus WT, Δppx
and ΔppxC grown in LB to log-phase. The results are from three measurements.
***, p < 0.01.
Figure 3: Motility and biofilm formation of WT and mutant. (A) Motility.
Cells were inoculated on swimming plates with 12-h incubation at 30°C
and they were photographed. Each is representative of the strain; (B)
Biofilm formation. An overnight LB culture (2μl) was inoculated into
200 μL of LB in 96-well plates and incubated at 30°C without shaking.
After 12-h incubation, the media were removed; each well was rinsed
with sterile water, and were stained with crystal violet, extracted and
measured. Data represent mean values and standard deviations for
eight replicates. ***, p < 0.01.
western blot. Results suggested that binary toxins production by
the Δppx was significant lower compared with WT at different
times (Figure 5B and C). Bioassay results against fourth instar
larvae showed that the toxicity of Δppx was significant lower
than that of wild type (Table 3). The binary toxins production and
toxicity could be partially restored by expression of ppx gene in
the mutant strain.
Discussion
In the present study, we identified the PPX function of L.
sphaericus C3-41 and disrupted the ppx gene with homologous
recombination. PolyP extraction and quantitation showed
that polyP were significantly more abundant in Δppx than
in WT. Moreover, our data indicated that a high intracellular
concentration of polyP in the Δppx compromised the resistance of
L. sphaericus to high osmotic stress, high pH and high temperature,
Figure 4: Effect of a mutant in ppx from L. sphaericus on growth under
different stress conditions. Growth curves of L. sphaericus strains (WT,
Δppx and ΔppxC are shown. (A) Growth in LB medium; (B) growth in LB
medium with 0.6 M NaCl; (C) growth in LB medium adjusted to pH 9;
(D) growth in LB medium at 42°C. The results are the means of at least
three experiments.
Figure 5: Effect of a mutant in ppx from L. sphaericus on growth and
binary toxins production grown in MBS medium. (A) Growth curves of
WT, Δppx and ΔppxC; (B) western blot analysis of binary toxins proteins
synthesis WT, Δppx and ΔppxC.
Table 3: Larvicidal activity of L. sphaericus C3-41, Δppx and ΔppxC.
Strains |
LC50*(95% CL)† |
LC90*(95% CL)† |
C3-41 |
0.320 (1.154 < CL < 2.043)† |
5.218 (3.797 < CL < 8.548)† |
∆ppx |
9.544 (16.021 < CL < 28.601)† |
36.459 (25.364 < CL < 71.270) |
∆ppxC |
2.339 (3.251 < CL < 4.438)† |
7.224 (9.111 < CL < 12.602)† |
*LC50 and LC90, volume (in μL) of cultures of L. sphaericus C3-41, Δppx
and ΔppxC.
†95% CL, 95% confidence limits.
and impaired mobility and biofilm formation. Biofilm formation
and motility is one of ways to adapt to stresses and stringencies
by concentrating nutrients and escaping environmental stresses
[22]. Previous study showed that ppk gene knockout resulted
in polyP deficiency and affected the growth of L. sphaericus C3-
41[12]. These results suggested that maintenance of the polyP
levels within a normal range were essential for growth and its
responses to stresses.
The Binary toxins comprises two proteins, BinA and BinB
that are co-transcribed from a single operon just before the end
of exponential growth and into sporulation, and strains blocked
in early stage sporulation do not accumulate toxin crystals
[10]. Presently, information about the expression control of
toxin was rare. Notably, El-Bendary et al. [23] identified two
genes involved in sporulation, spo0A and spoIIAC, which
might control expression of the binary toxin genes. Our lab
identified several sporulation-associated genes by transposonmediated
insertional mutagenesis, which affected expression
of binary toxin genes [24]. These studies indicated that crystal
protein synthesis is dependent on initiation of sporulation
in L. sphaericus. In this study, we found that ppx disruption
compromised the production of binary toxins. Although the B.
cereus Δppx impaired sporulation efficiency [4], the impairment
of sporulation in L. sphaericus Δppx was not observed (result
not shown). Possibly, polyP affected binary toxins production by
other unknown reasons, which remain to be investigated.
In summary, we provide evidence that ppx mutation
accumulated massive polyP, compromised resistance to high
osmotic stress, high pH and high temperature, and impaired
motility and biofilm formation, and toxin production.
Acknowledgements
We thank Shinichi Kato (Regene Tiss Inc.) for supplying
polyP14, polyP60 and polyP130 kindly. This project were
supported by NFSC grants (30800002 and 31272384) and
Doctoral scientific research of Hubei University for nationalities
(MY2015B024).
Conflict of Interest
The authors declare that they have no conflicts of interest.
- Rao NN, Gómez-García MR, Kornberg A. Inorganic polyphosphate: essential for growth and survival. Annu Rev Biochem. 2009;78:605-47. doi: 10.1146/annurev.biochem.77.083007.093039.
- Kornberg A, Rao NN, Ault-Riché D. Inorganic polyphosphate: a molecule of many functions. Annu Rev Biochem. 1999;68:89-125.
- Akiyama M, Crooke E, Kornberg A. An exopolyphosphatase of Escherichia coli. The enzyme and its ppx gene in a polyphosphate operon. J Biol Chem. 1993;268(1):633-9.
- Shi X, Rao NN, Kornberg A. Inorganic polyphosphate in Bacillus cereus: motility, biofilm formation, and sporulation. Proc Natl Acad Sci U S A. 2004;101(49):17061-5.
- Frenzel E, Letzel T, Scherer S, Ehling-Schulz M. Inhibition of cereulide toxin synthesis by emetic Bacillus cereus via long-chain polyphosphates. Appl Environ Microbiol. 2011;77(4):1475-82. doi: 10.1128/AEM.02259-10.
- Maier SK, Scherer S, Loessner MJ. Long-chain polyphosphate causes cell lysis and inhibits Bacillus cereus septum formation, which is dependent on divalent cations. Appl Environ Microbiol. 1999;65(9):3942-9.
- Doruk T, Avican U, Camci IY, Gedik ST. Overexpression of polyphosphate kinase gene (ppk) increases bioinsecticide production by Bacillus thuringiensis. Microbiol Res. 2013;168(4):199-203. doi: 10.1016/j.micres.2012.11.009.
- Baumann P, Unterman BM, Baumann L, Broadwell AH, Abbene SJ, Bowditch RD. Purification of the larvicidal toxin of Bacillus sphaericus and evidence for high-molecular-weight precursors. J Bacteriol. 1985;163(2):738-47.
- Broadwell AH, Linda Baumann, Paul Baumann. Larvicidal properties of the 42 and 51 Kilodalton Bacillus sphaericus proteins expressed in different Bacterial hosts: evidence for a binary toxin. Current Microbiology. 1990;21(6): 361-366.
- Berry C. The bacterium, Lysinibacillus sphaericus, as an insect pathogen. J Invertebr Pathol. 2012;109(1):1-10. doi: 10.1016/j.jip.2011.11.008.
- Opota O, Gauthier NC, Doye A, Berry C, Gounon P, Lemichez E, et al. Bacillus sphaericus binary toxin elicits host cell autophagy as a response to intoxication. PLoS One. 2011;6(2):e14682. doi: 10.1371/journal.pone.0014682.
- Shi T, Ge Y, Zhao N, Hu X, Yuan Z. Polyphosphate kinase of Lysinibacillus sphaericus and its effects on accumulation of polyphosphate and bacterial growth. Microbiol Res. 2015;172:41-7. doi: 10.1016/j.micres.2014.12.002.
- Schnepf E, Crickmore N, Van Rie J, Lereclus D, Baum J, Feitelson J, et al. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol Mol Biol Rev. 1998;62(3):775-806.
- Yuan Z, Zhang Y, Liu E. Efficacy of Bacillus sphaericus C3-41 against Culex quinquefasciatus and its recycling in cadavers. Acta Entomologica Sinica. 1994;37(4):404-410.
- Vallet-Gely I, Lemaitre B, Boccard F. Bacterial strategies to overcome insect defences. Nat Rev Microbiol. 2008;6(4):302-13. doi: 10.1038/nrmicro1870.
- Brown MR, Kornberg A. The long and short of it - polyphosphate, PPK and bacterial survival. Trends Biochem Sci. 2008;33(6):284-90. doi: 10.1016/j.tibs.2008.04.005.
- Kalfon A, Charles JF, Bourgouin C, de Barjac H. Sporulation of Bacillus sphaericus 2297: an electron microscope study of crystal-like inclusion biogenesis and toxicity to mosquito larvae. J Gen Microbiol. 1984;130(4):893-900.
- Ault-Riché D, Fraley CD, Tzeng CM, Kornberg A. Novel assay reveals multiple pathways regulating stress-induced accumulations of inorganic polyphosphate in Escherichia coli. J Bacteriol. 1998;180(7):1841-7.
- Alcántara C, Blasco A, Zúñiga M, Monedero V. Accumulation of polyphosphate in Lactobacillus spp. and its involvement in stress resistance. Appl Environ Microbiol. 2014;80(5):1650-9. doi: 10.1128/AEM.03997-13.
- Rashid MH, Rumbaugh K, Passador L, Davies DG, Hamood AN, Iglewski BH, et al. Polyphosphate kinase is essential for biofilm development, quorum sensing, and virulence of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A. 2000;97(17):9636-41.
- Yang Y, Wang L, Gaviria A, Yuan Z, Berry C. Proteolytic stability of insecticidal toxins expressed in recombinant Bacilli. Appl Environ Microbiol. 2007;73(1):218-25.
- Davey ME, O'toole GA. Microbial biofilms: from ecology to molecular genetics. Microbiol Mol Biol Rev. 2000;64(4):847-67.
- El-Bendary M, Priest FG, Charles JF, Mitchell WJ. Crystal protein synthesis is dependent on early sporulation gene expression in Bacillus sphaericus. FEMS Microbiol Lett. 2005;252(1):51-6.
- Wu Y, Hu X, Ge Y, Zheng D, Yuan Z. Generation of mariner-based transposon insertion mutant library of Bacillus sphaericus 2297 and investigation of genes involved in sporulation and mosquito-larvicidal crystal protein synthesis. FEMS Microbiol Lett. 2012;330(2):105-12. doi: 10.1111/j.1574-6968.2012.02539.x.