2Department of Microbiology, Pasteur Institute of Iran, Tehran. Pasteur Institute of Iran.
3Department of Microbiology, Medical Science Faculty, Mazandaran University of Medical Science.
Keywords: Enterococcus spp., spontaneously abortion, virulence factors, Genomic patterns
Aggregation substance encoded by asa1, as a pheromoneresponsive, for self-transferable plasmids, enterococcal surface protein encoded by chromosomal esp, which provide the possibility of immune system evasion in case of immune deficiency and the role of enterococcal surface protein in colonization and prolonged remain in the urinary tract, biofilm development and high virulence have been proved [21-24]. During puberty due to the presence of aerobic and anaerobic acid producing Lactobacillus, vagina’s pH tends towards a more acidic pH which this provides an effective natural protection for the vagina against pathogens. If disruption of normal vaginal flora occurs, fungus and other microorganisms proliferate and lead to local manifestation of inflammations. Normal vaginal flora includes alpha-hemolytic streptococcus, anaerobic streptococcus (pepto streptococci), prevotella, clostridium, Gardnerella vaginalis, Ureaplasma urealyticum and sometimes listeria or mobiluncus species as well as lactobacillus. In some women vaginal opening possesses lots of bacteria similar to those which present in preneum and area around the anus. Presence of these kinds of bacteria provides the possibility of frequent urinary tract infections.Some bacteria such as Eshershia coli and enterococcus which reside in vagina and also proliferate there, because of proximity with anus have gastro vascular and fecal origins [4,25].
The aim of this study was to study prevalence of enterococcus species in vaginal swabs and investigation of clonal relationship of the isolates regards to antibiotic resistance patterns and virulence genes.
Briefly, growth colony harvested by centrifuge 8000 rpm for 5 minutes. The pellets consisting of bacterial cells were used for DNA extraction process. Following three times boil and freezing procedure, total DNA was purified by high pure DNA extraction kits (Roche, Mannheim, Germany). Dried DNA was dissolved in 50 μl of distilled water. Consequently, quantity of DNA was measured by Nanodrope (Spectrophotometer 1000) and adjusted to 300 ng/μL.
Statistical analysis was accomplished taking advantage of Graph pad online software (Unpaired t test) and p < 0.05 considered as significant
Gene and primer |
Sequence (5' to 3') |
Products size (bp) |
esp |
TTGCTAATGCTAGTCCACGACC |
933 |
efaAfs |
GACAGACCCTCACGAATA |
705 |
asa1 |
CCAGCCAACTATGGCGGAATC |
529 |
A: PCR of esp gene- fragment size 933 bp, Columns 2, 4, 5, strains of enterococci that were positive for the gene, Column + and - : E. faecalis MMH 594strain positive control and a negative control (water), Column M: Marker 100 bp.
B: PCR of efaAfs gene- fragment size 705 bp, Columns 1,3-9, strains of enterococci that were positive for the gene, Column + and - : E. faecalis ATCC 29212 positive control and a negative control (water), Column M: Marker 100 bp.
C: PCR of asa1 gene- fragment size 529 bp, Columns 1-9, strains of enterococci that were positive for the gene, Column + and - : E. faecalis MMH 594 positive control and a negative control (water), Column M: Marker 100 bp.
|
E. faecalis (1% agarose gel) |
E. faecium (1% agarose gel) |
1Mode: |
1 |
1 |
Initial time: |
1 sec |
1 sec |
Final time: |
10 sec |
13 sec |
Start ratio: |
1 |
1 |
Running time: |
15 h |
13 h |
2Mode: |
10 |
10 |
Initial time: |
10 sec |
13 sec |
Final time: |
40 sec |
30 sec |
Start ratio: |
1 |
1 |
Running time |
10 h |
5 h |
3Mode: |
11 |
11 |
Detailed data for each antibiotic pattern was indicated at the Table 3.
According to CLSI (2011), High- level resistance to gentamicin (MIC ≥ 500 μg/ml), ciprofloxacin (MIC ≥ 32 μg/ml) and vancomycin (MIC ≥ 64 μg/ml) was detected in 5.5%, 3.17% and 0.8% of the isolates, respectively. In addition, 19 (15%) of the isolates were resistant to ciprofloxacin (MIC ≥ 4 μg/ml).
It was found that 46 of 126 enterococcus strains (36.5%) were positive for the esp gene that contained 32 E. faecalis (25.3%) and 14 E. faecium strains (11.1%).
Our study also showed that only 91 strains (72.2%) containing a set of 64 E. faecalis (50.7%) and 27 E. faecium (21.4%) strains were documented for the presence of efaAfs gene.
In addition, asa1 gene was found in 81 strains (64.2%) among them 55 (43.6%) and 26 (20.6%) strains have been associated to E. faecalis and E. faecium, respectively (Details have been listed in Figure 3).
All in all, in dendrogram of E. faecalis 7 pulse-type included more than one strain identified while in dendrogram of E. faecium only one pulse-type included two strains with similar pattern.
MIC |
Disk Diffusion |
|||||||||||
GM |
CIP |
VA |
OX |
VA |
TEC |
GM |
E |
CIP |
C |
CTX |
IPM |
|
HLGR |
S |
S |
R |
S |
I |
S |
R |
R |
R |
S |
S |
|
HLGR |
S |
S |
R |
S |
I |
S |
R |
S |
S |
I |
S |
|
S |
HLR |
S |
R |
S |
I |
S |
I |
I |
S |
I |
S |
|
S |
S |
S |
R |
S |
I |
S |
S |
I |
S |
R |
S |
|
S |
S |
S |
R |
S |
I |
R |
R |
S |
S |
I |
S |
|
HLGR |
R |
S |
R |
S |
S |
R |
R |
I |
S |
S |
S |
|
HLGR |
S |
S |
R |
S |
I |
R |
R |
I |
S |
S |
S |
|
HLGR |
S |
S |
R |
S |
I |
R |
R |
S |
R |
S |
S |
|
S |
R |
S |
R |
S |
I |
R |
R |
I |
S |
I |
S |
|
S |
S |
S |
R |
S |
R |
R |
R |
I |
S |
R |
S |
|
S |
R |
S |
R |
S |
I |
S |
S |
I |
S |
R |
S |
|
HLGR |
S |
S |
R |
I |
R |
R |
R |
I |
R |
R |
S |
|
S |
S |
S |
R |
S |
I |
R |
R |
S |
S |
S |
S |
|
S |
S |
S |
R |
S |
I |
S |
R |
R |
R |
S |
S |
|
S |
S |
S |
R |
S |
I |
S |
R |
S |
S |
I |
S |
|
S |
S |
S |
R |
S |
I |
S |
I |
I |
S |
I |
S |
|
S |
S |
S |
R |
S |
I |
R |
R |
S |
S |
I |
S |
|
S |
S |
S |
R |
I |
R |
R |
R |
I |
S |
I |
S |
|
S |
S |
S |
R |
S |
S |
S |
R |
S |
R |
S |
S |
|
S |
S |
S |
R |
S |
I |
S |
S |
S |
|
I |
S |
|
S |
S |
S |
R |
S |
I |
S |
S |
S |
|
S |
S |
|
S |
S |
S |
R |
S |
S |
S |
R |
S |
|
I |
S |
|
S |
S |
S |
R |
R |
R |
S |
R |
S |
|
I |
S |
|
S |
S |
S |
R |
S |
S |
S |
S |
I |
|
S |
S |
|
S |
S |
S |
R |
S |
R |
R |
R |
S |
|
I |
S |
|
S |
S |
S |
R |
S |
S |
S |
R |
S |
|
S |
S |
|
S |
S |
S |
R |
S |
R |
R |
R |
S |
|
R |
S |
|
S |
S |
S |
R |
S |
I |
S |
R |
S |
|
R |
S |
|
S |
S |
S |
R |
S |
I |
S |
R |
I |
|
R |
S |
|
S |
S |
S |
R |
S |
I |
S |
I |
S |
|
I |
S |
|
HLGR |
S |
S |
R |
S |
I |
S |
R |
S |
S |
I |
S |
|
S |
S |
S |
R |
I |
I |
I |
I |
S |
R |
S |
|
|
S |
S |
S |
I |
I |
S |
S |
S |
S |
S |
S |
|
|
S |
R |
S |
R |
S |
I |
I |
R |
I |
S |
S |
|
|
S |
S |
S |
R |
I |
I |
I |
S |
R |
S |
S |
|
|
S |
S |
S |
R |
S |
I |
R |
R |
S |
S |
S |
|
|
S |
S |
S |
R |
S |
I |
R |
R |
I |
S |
S |
|
|
S |
S |
S |
R |
S |
I |
R |
R |
R |
I |
S |
|
|
S |
S |
S |
R |
S |
R |
S |
S |
S |
I |
S |
|
|
S |
R |
S |
R |
S |
R |
R |
R |
I |
I |
S |
|
|
S |
R |
S |
R |
I |
I |
I |
R |
I |
R |
S |
|
|
S |
S |
S |
R |
S |
R |
R |
R |
S |
R |
S |
|
|
S |
S |
S |
R |
S |
I |
S |
R |
S |
R |
S |
|
|
S |
S |
S |
R |
S |
I |
R |
R |
S |
S |
S |
|
|
S |
S |
S |
R |
S |
I |
R |
S |
R |
R |
S |
|
|
S |
S |
S |
R |
S |
S |
I |
R |
S |
R |
S |
|
|
S |
S |
S |
R |
S |
S |
R |
R |
S |
S |
S |
|
|
S |
R |
S |
R |
S |
R |
I |
R |
S |
R |
S |
|
|
S |
R |
S |
R |
I |
R |
I |
R |
R |
R |
S |
|
|
S |
R |
R |
R |
I |
R |
I |
S |
I |
I |
S |
|
|
HLGR |
S |
S |
R |
S |
I |
R |
R |
I |
I |
S |
|
|
S |
HLR |
S |
R |
S |
S |
R |
R |
R |
S |
S |
|
|
S |
HLR |
S |
R |
S |
S |
I |
R |
R |
S |
S |
|
|
S |
HLR |
S |
R |
S |
S |
I |
R |
R |
S |
S |
|
|
S |
S |
S |
R |
S |
I |
S |
I |
I |
I |
S |
|
|
S |
R |
S |
R |
S |
I |
R |
R |
I |
I |
S |
|
|
S |
HLR |
S |
R |
S |
S |
R |
R |
R |
S |
S |
|
|
S |
HLR |
S |
R |
S |
S |
I |
R |
R |
S |
S |
|
|
S |
HLR |
S |
R |
S |
S |
I |
R |
R |
S |
S |
|
|
S |
S |
S |
R |
S |
I |
S |
I |
I |
I |
S |
|
|
S |
R |
S |
R |
S |
I |
R |
R |
I |
I |
S |
|
|
S |
HLR |
S |
R |
S |
S |
R |
R |
R |
S |
S |
|
|
S |
HLR |
S |
R |
S |
S |
I |
R |
R |
S |
S |
|
|
S |
HLR |
S |
R |
S |
S |
I |
R |
R |
S |
S |
|
|
Antibiotics |
Resistance |
Intermediate |
Sensitive |
Oxacillin |
100% |
0% |
0% |
Cefotaxime/Clavulanic acid |
36.5% |
31.7% |
31.7% |
Imipenem |
0% |
0% |
100% |
Gentamicin |
29.3% |
15.8% |
54.7% |
Vancomycin |
3.1% |
14.2% |
82.5% |
Teicoplanin |
18.2% |
69% |
12.6% |
Erythromycin |
63.4% |
17.4% |
19% |
Chloramphenicol |
15.8% |
1.5% |
82.5% |
Ciprofloxacin |
11.1% |
31.7% |
57.1% |
The PFGE has been performed to investigate the phylogenetic association of resistant strains carrying virulence genes. In this investigation, 7 out of 29 obtained pulse-types from E. faecalis consisted of more than one strain. In other words, these types two or several strains with identical pattern were identified (Figure 2, 3). Pulse-types number 17 and 27 included the highest number of strains (4 and 3, respectively). In the pulse-type number 17, 3 out of 4 strains represented identical pattern and another strain was closely related and showed more than 90 % similarity. In this pulse-type, similar antibiotic resistance pattern as well as similar genotype based on virulence genes (esp, asa1, efAfs) were identified with the exception of closely related strain which was different in resistance to erythromycin and teicoplanin. Moreover, in this dendrogram pulse-type number 28 consisted of two closely related strains with completely different resistance to gentamicin. It appears that one of the way of developing resistance against amino glycosides is to acquire resistance gene via conjugative transposons.
Resistance to CIP were observed among the strains both in the same or different pulse-types. Strain 154 has been isolated from a hospitalized patient and represented MIC ≥ 4 μg/ml to ciprofloxacin while its similar strain (167) has been isolated from an outpatient with no resistance to ciprofloxacin. This demonstrated that resistance to CIP is possibly acquired in the hospital. According to our results, ciprofloxacin resistant strains (MIC ≥ 4 μg/ml) or high gentamicin resistant strains (MIC ≥ 512 μg/ml) have been classified in different pulse-types in both dendrogram and this demonstrated resistance dissemination in various clones with different sources showing horizental transfer of resistance among different strains. Two distinct outpatients were observed in pulse-types 7 and 17 which may be indicative of strain’s distribution in a non-hospital setting that requires further study in this field. According to dendrogram of 20 E. faecium isolates, only one pulse-type (number 1) included two identical strains with similar virulence genotype as well as identical antibiotic resistance patterns with the exceptation of C antibiotic was obtained. Other E .faecium strains were classified in one pulse-type distinctly. Strain 28 which is ordered in pulsetype number 10 represented high resistance to vancomycin and this provide evidence that the origin of this strain is totally different and fortunately it showed no clonal dissemination. Like the results of our study, more similarity amongst E. faecalis strains than E. faecium was observed previously [16]. Recent studies, provided the evidence that the strains could disseminate easily due to either lack of hygiene in hospital’s staff or lack of appropriate isolation in patients possessing infection caused by resistant strains and this phenomenon could occur in different hospitals as well as society [30,32-35]. If the control of infection does not exert in hospitals, these resistant strains possessing virulent genes would be disseminated either from one individual to another one or from one hospital to another one via patients or staffs. Sometimes the disseminated clone has important characteristic such as virulent gene or high resistance, so that preventing of such strains from spread is very important. Studies on one prevalent epidemic clone in the burn unit of a hospital in Taiwan showed that this epidemic clone remained longer in patient’s body than non-clonal strains and cause various and severe infections [36]. Since the strains with identical genotypes from aspect of virulent genes represented different types of PFGE or the strains with different genotype showed similar patterns, it could be identified that there is no association between virulent genotypes and PFGE patterns. The typing method for high level ciprofloxacin, gentamicin and vancomycin resistant enterococcus harboring possessing virulent genes represented differences between these isolates due to different isolates origin. Luckily, in the current study no prevalent clonal dissemination amongst strains has been observed but according to result’s interpretation of two dendrogram corresponded to E. faecalis and E. faecium, 5 and 1 pulse-types possessed common strains was observed, respectively. Since the common strains could survive in hospitals, antibiotic resistance information such as anti biogram and minimum inhibitory concentration could help to control of infection effectively. Moreover, by proper hygiene measures clonal dissemination could best be prevented in the future.
- Cetinkaya Y, Falk P, Mayhall CG. Vancomycin-resistant enterococci. Clin Microbiol Rev. 2000;13(4):686-707.
- Huycke MM, Sahm DF, Gilmore MS. Multiple-drug resistant enterococci: The nature of the problem and an agenda for the future. Emerg Infect Dis. 1998;4(2):239-249.
- Jones RN, Marshall SA, Pfaller MA, Wilke WW, Hollis RJ, Erwin ME, et al. Nosocomial enterococcali blood stream infections in the SCOPE program: antimicrobial resistance, species occurrence, molecular testing results and laboratory testing accuracy. SCOPE Hospital Study Group. Diagn Microbiol Infect Dis. 1997;29(2):95-102.
- Donskey CJ, Schreiber JR, Jacobs MR, Shekar R, Salata RA, Gordon S, et al. A polyclonal outbreak of predominantly VanB vancomycin-resistant enterococci in North East Ohio. Northeast Ohio vancomycin-resistant Enterococcus surveillance program. Clin Infect Dis. 1999;29(3):573-579.
- Mirzaei B, Farivar TN, Juhari P, Mehr MA, Babaei R. Investigation of the Prevalence of vanA and vanB genes in vancomycin resistant enterococcus (VRE) by Taq Man real time PCR Assay. JMID. 2013;3(4):192-198.
- Nelson RR, McGregor KF, Brown AR, Amyes SG, Young HK. Isolation and characterization of glycopeptide-resistant enterococci from hospitalized patients over a 30-month period. J Clin Microbiol. 2000;38(6):2112-2116.
- Olmsted SB, Dunny GM, Erlandsen SL, Wells CL. A plasmid-encoded surface protein on Enterococcus faecalis augments its internalization by cultured intestinal epithelial cells. J Infect Dis. 1994;170(6):1549-1556.
- Quale J, Landman D, Atwood E, Kreishwirth B, Willey BM, Ditore V, et al. Experience with a hospital-wide outbreak of vancomycin-resistant enterococci. Am J Infect Control. 1996;24(5):372-379.
- Schouten MA, Hoogkamp-Korstanje JA, Meis JF, Voss A. Prevalence of vancomycin-resistant enterococci in Europe. Eur J Clin Microbiol Infect Dis. 2000;19(11):816-822.
- Linden PK, Pasculle AW, Manez R, Kramer DJ, Fung JJ, Pinna AD, et al. Differences in outcomes for patients with bacteremia due to vancomycin-resistant Enterococcus faecium or vancomycin susceptible E. faecium. Clin Infect Dis. 1996;22(4):663-670.
- Cariolato D, Andrighetto C, Lombardi A. Occurrence of virulence factors and antibiotic resistances in Enterococcus faecalis and Enterococcus faecium collected from dairy and human samples in North Italy. Food Control, 2008;19:886–892.
- Eaton TJ, Gasson MJ. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl Environ Microbiol. 2001;67(4):1628-1635.
- Franz CM, Holzapfel WH, Stiles ME. Enterococci at the crossroads of food safety? Int J Food Microbiol. 1999;47(1-2):1-24.
- Reinert RR, Conrads G, Schlaeger JJ, Werner G, Witte W, Lütticken R, Klare I. Survey of antibiotic resistance among enterococci in North Rhine-Westphalia, Germany. J Clin Microbiol. 1999;37(5):1638-1641.
- Semedo T, Santos MA, Lopes MF, Marques JJ, Crespo MT, Tenreiro R. Virulence factors in food, clinical and reference enterococci: A common trait in the genus? Syst Appl Microbiol. 2003;26(1):13-22.
- Valenzuela AS, Omar NB, Abriouel H, López RL, Ortega E, Cañamero MM, et al. Risk factors in enterococci isolated from foods in Morocco: Determination of antimicrobial resistance and incidence of virulence traits. Food Chem Toxicol. 2008;46(8):2648-2652.
- Franz CM, Muscholl-Silberhorn AB, Yousif NM, Vancanneyt M, Swings J, Holzapfel WH. Incidence of virulence factors and antibiotic resistance among enterococci isolated from food. Appl Environ Microbiol. 2001;67(9):4385-4389.
- Giraffa G. Enterococci from foods. FEMS Microbiol Rev. 2002;26(2):163-171.
- Guzman CA, Pruzzo C, LiPira G, Calegari L. Role of adherence in pathogenesis of Enterococcus faecalis urinary tract infection and endocarditis. Infect Immun. 1989;57(6):1834-1838.
- Lloyd S, Zervos M, Mahayni R, Lundstrom T. Risk factors for enterococcali urinary tract infection and colonization in a rehabilitation facility. Am J Infect Control. 1998;26(1):35-39.
- Galli, D, Lottspeich, F, Wirth, R. Sequence analysis of Enterococcus faecalis agg regation substance encoded by the sex pheromone plasmid pAD1. Mol Microbiol. 1990;4(6):895-904.
- Shankar V, Baghdayan AS, Huycke MM, Lindahl G, Gilmore MS. Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein. Infect Immun. 1999;67(1):193-200.
- Seno Y, Kariyama R, Mitsuhata R, Monden K, Kumon H. Clinical implications of biofilm formation by Enterococcus faecalis in the urinary tract. Acta Med Okayama. 2005;59(3):79-87.
- Toledo-Arana A, Valle J, Solano C, Arrizubieta MJ, Cucarella C, Lamata M, et al. The enterococcali surface protein, Esp, is involved in Enterococcus faecalis biofilm formation. Appl Environ Microbiol. 2001;67(10):4538-4545.
- Creti R, Imperi M, Bertuccini L, Fabretti F, Orefici G, Di Rosa R, et al. Survey for virulence determinants among Enterococcus faecalis isolated from different sources. J Med Microbiol. 2004;53(Pt 1):13-20.
- Mannu L, Paba A, Daga E, Comunian R, Zanetti S, Duprè I, et al. Comparison of the incidence of virulence determinants and antibiotic resistance between Enterococcus faecium strains of dairy, animal and clinical origin. Int J Food Microbiol. 2003;88(2-3):291-304.
- Mirzaei B, Babaei R, Asiabar AP, Bameri Z. Detection of both vanA & vanB genes in vanA phenotypes of Enterococci by Taq Man RT-PCR. Braz J Microbiol. 2015;46(1):161-165.
- Jahangiri S, Talebi M, Eslami G, Pourshafie MR. Prevalence of virulence factors and antibiotic resistance in vancomycin-resistant Enterococcus faecium isolated from sewage and clinical samples in Iran. Indian J Med Microbiol. 2010;28(4):337-341.
- Oancea DP. enterococcali surface protein (Esp) œ epidemiology and transfer between enterococcali strains (Doctoral dissertation).
- Hsueh PR, Teng LJ, Yang PC, Chen YC, Ho SW, Luh KT. Persistence of a multidrug-resistant Pseudomonas aeruginosa clone in an intensive care burn unit. J Clin Microbiol. 1998;36(5):1347-1351.
- Seubwai C, Tattawawart U, Engchanill C .Virulence Factors in High-level Gentamicin Resistant Enterococcus faecalis Isolates from Hospitalized Patients. Srinagarind Med J.2011;26(3):207-212.
- Lee SC, Wu MS, Shih HJ, Huang SH, Chiou MJ, See LC, et al. Identification of vancomycin-resistant enterococci clones and inter-hospital spread during an outbreak in Taiwan. BMC Infect Dis. 2013;13:163.
- Morris JG, Shay DK, Hebden JN, McCarter RJ, Perdue BE, Jarvis W, et al. Enterococci resistant to multiple antimicrobial agents, including vancomycin. Establishment endemicity in a university medical center. Ann Intern Med. 1995;123(4):250-259.
- Nikbin VS, Abdi-Ali A, Feizabadi MM, Gharavi S. Pulsed field gel electrophoresis & plasmid profile of Pseudomonas aeruginosa at two hospitals in Tehran. Iran. Indian J Med Res. 2007;126(2):146-151.
- Smith TL, Iwen PC, Olson SB, Rupp ME. Environmental contamination with vancomycin-resistant enterococci in an outpatient setting. Infect Control Hosp Epidemiol. 1998;19(7):515-518.
- Weng PL, Ramli R, Shamsudin MN, Cheah YK, Hamat RA. High genetic diversity of Enterococcus faecium and Enterococcus faecalis clinical isolates by pulsed-field gel electrophoresis and multilocus sequence typing from a hospital in Malaysia. Biomed Res Int. 2013;2013:938937.





