Research Article
Open Access
Laser Microdissection of Pancreatic Islets Allows for
Quantitative Real-Time PCR Detection of Islet-Specific Gene
Expression in Healthy and Diabetic Cats
Malin Öhlund1, Petra Franzen2, Göran Andersson3, Bodil Ström Holst1 and Joey Lau2*
1Department of Clinical Sciences, Swedish University of Agricultural Sciences, Box 7054, SE-750 07 Uppsala, Sweden
2Department of Medical Cell Biology, Uppsala University, Box 571, SE-751 23 Uppsala, Sweden
3Department of Animal Breeding and Genetics, Swedish University of Agricultural Sciences, Box 7023, SE-750 07 Uppsala, Sweden
*Corresponding author: Joey Lau, Department of Medical Cell Biology, Uppsala University, Box 571, SE-751 23 Uppsala, Sweden, Tel: +46-18-471-4395;
Fax: +46-18-471-4059; E-mail:
@
Received: September 24, 2014; Accepted: November 20, 2014; Published: December 05, 2014
Citation: Öhlund M, Franzen P, Andersson G, Holst BS, Lau J (2014) Laser Microdissection of Pancreatic Islets Allows for Quantitative
Real-Time PCR Detection of Islet-Specific Gene Expression in Healthy and Diabetic Cats. Gastroenterol Pancreatol Liver Disord 1(4):
1-9.
http://dx.doi.org/10.15226/2374-815X/1/4/00121
Background: Feline diabetes mellitus shares many similarities
with human type 2 diabetes mellitus, including clinical, physiological
and pathological features of the disease. The domestic cat
spontaneously develops diabetes associated with insulin resistance in
their middle age or later, with residual but declining insulin secretion.
Humans and cats share largely the same environment and risk factors
for diabetes, such as obesity and physical inactivity. Moreover,
amyloid formation and loss of beta cells are found in the islets of the
diabetic cat, as in humans. Altogether, the diabetic cat is a good model
for type 2 diabetes in humans. The aims of the present study were
to isolate feline islets using laser microdissection and to develop a
quantitative method for detection of mRNA levels in islets of healthy
and diabetic cats.
Results: By using the laser microdissection technique, we were
able to meticulously sample islets from both healthy and diabetic cats.
Insulin staining of separate sections showed many beta cells in islets
from healthy cats, whereas few insulin positive cells were found in
islets from diabetic cats. By quantitative real-time PCR, mRNA levels
of the islet-specific genes INS, PDX1, IAPP, CHGA and IA-2 could be
detected in both healthy and diabetic cats.
Conclusions: Laser microdissection allows distinct studies of
islets without contamination of acinar cells. Previous attempts in
isolating feline islets with different collagenase-based protocols have
led to damaged islets or islets coated with exocrine acinar cells, which
either way compromise the results obtained from gene expression
studies. The use of the laser microdissection technique eliminates
these problems as shown in this study. Differences in gene expression
between healthy and diabetic cats can reveal underlying mechanisms
for beta cell dysfunction and decreased beta cell mass in human type
2 diabetes.
Keywords: Beta cell; Type 2 Diabetes mellitus; Felis catus; Gene
expression; Islet isolation; Laser microdissection; Pancreatic islets
Abbreviations
LMD: Laser Microdissection; qPCR: quantitative real-time
Polymerase Chain Reaction; T2DM: Type 2 Diabetes Mellitus; BP:
Base Pair; INS: Insulin; PDX1: Pancreatic and Duodenal Homeobox
1; CHGA: Chromogranin A; IA-2: Islet Cell Antigen 2; IAPP: Islet Amyloid Polypeptide; PNLIP: Pancreatic Lipase; ACTB: Beta-
Actin; GAPDH: Glyceraldehyde 3-Phosphate Dehydrogenase;
RPS7: Ribosomal Protein S7; IHC: Immunohistochemistry;
HRP: Horseradish Peroxidase; DAB: Diaminobenzidine
Tetrahydrochloride
Introduction
Feline diabetes mellitus shares many similarities with
Type 2 Diabetes Mellitus (T2DM) in humans, including clinical,
physiological and pathological features of the disease. The
domestic cat has thus been proposed a valuable animal model for
T2DM [1,2]. Cats spontaneously develop diabetes associated with
insulin resistance in their middle age or later, with residual but
declining insulin secretion. Humans and cats largely share the
same environment and also many of the risk factors for diabetes,
such as obesity and physical inactivity. The diabetic cat may also
develop late complications such as peripheral polyneuropathy,
retinopathy, and nephropathy [1-5]. Amyloid deposition in islets,
associated with an approximately 50% loss of beta-cell mass,
is described in over 80% of cats with diabetes, as in human
T2DM [6-9]. Amyloid formation is not seen in any of the rodent
models of T2DM [1] and is a clear advantage for the feline model.
Characterizing molecular mechanisms for beta cell dysfunction
and decreased beta cell mass in feline diabetes may elucidate
factors and mechanisms responsible for the development of type
2 diabetes in both cats and humans.
It is difficult to isolate feline islets without contamination
with exocrine tissue, and it has been suggested that feline islets
are particularly difficult to isolate with collagenase digestion
because they are delimited with very little peri-islet matrix
[10,11]. This leads to either damaged islets, or islets coated with
acinar cells (referred to in the literature as islet-like cell clusters)
[11,12], which either way compromise the results obtained from
gene expression studies. The use of the Laser Microdissection
(LMD) technique can eliminate some of the problems inherent
in the use of collagenase-isolated islets [13]. The technique has
been used successfully in human and rodent islet isolations [13-17]. LMD can be used selectively to cut out islets without visible
contamination of acinar cells, and the technique also avoids some
of the problems associated with trauma and stress to the cells by
the enzymatic isolation that will cause changes in gene expression
[13]. LMD of human beta-cells, recognized by their intrinsic
autofluorescence, is performed on pancreatic tissue obtained
from heart-beating cadaveric donors or from surgical samples
from human pancreases [18]. The drawback with this approach
is the long cold ischemia time or the small study material from
surgical samples, since the islets only constitute 1-2% of the
pancreas. In the cat, the whole pancreas can be removed from
the euthanized animal and immediately snap frozen in liquid
nitrogen, which enables us to study islets as close to reality as
possible.
The aim of the present study was to develop a technique to
isolate feline islets in order to perform gene expression studies in
healthy and diabetic cats. This article reports a reliable method
to obtain feline islets from both healthy and diabetic cats, with
preserved RNA integrity for subsequent gene expression studies.
Material and Methods
Animals
Two healthy and two diabetic cats were included in the study.
Ethical approval for this study was obtained from the Uppsala
Ethical Committee on Animal Experiments (Dnr C 262/12). All
cats were euthanized on the owner’s request for reasons unrelated
to this study. Written consent was obtained from all owners
before inclusion in the study. Diabetic cats were diagnosed based
on clinical and laboratory findings consistent with persistent
hyperglycemia. The concentration of fructosamine in serum is
a reflection of mean blood glucose level over the preceding 1
to 3 weeks [19]. One of the diabetic cats (nr. 1) showed typical
clinical signs of diabetes for several months prior to diagnosis
and had lost more than 20% of its body weight. This cat also had
markedly elevated serum fructosamine levels, 752 μmol/L (ref
190-350) and was euthanized. The second diabetic cat (nr. 2) had
a short disease history and presented with only slightly elevated
serum fructosamine levels, 461 μmol/l, and was euthanized
due to reasons other than the diabetes. None of the cats had received insulin treatment. Cats were sedated with different
combinations of acepromazine (Plegicil® vet., Pharmaxim),
medetomidine (Sedator®, Dechra Veterinary Products) and
butorphanol (Dolorex vet., Intervet) given subcutaneously,
prior to euthanasia with an intravenous overdose of sodium
pentobarbital (Allfatal vet., Omnidea). Diagnosis of diabetes was
confirmed by postmortem examination and histopathology of
the pancreas. Pancreatic sections were also stained with Congo
red as previously described [20] to confirm presence of amyloid
in diabetic islets (Figure 1). Histopathological examination
indicated no infiltration of immune cells in diabetic islets.
Preparation of tissue for laser microdissection
Immediately after euthanasia the pancreata were surgically
excised from the cats under sterile conditions. The islet-dense
splenic portion of the pancreas [21] was sectioned and embedded
in frozen section medium (Richard-Allan Scientific NEG 50,
Thermo Scientific, Kalamazoo, MI, USA) in cryomolds (Tissue-
Tek® Cryomold®, Sakura Finetek Inc, Torrance, CA, USA) and
snap frozen in liquid nitrogen. Mean time from point of death to
snap freezing of pancreatic specimens was 13 min (range 10-17
min). Tissue samples were stored in -80°C until cryosectioning.
Frame slides (POL-Membrane 0.9 μm, Leica Microsystems,
Wetzlar, Germany) were exposed to UV-light overnight for
cross-linking of the membrane in order to improve cutting
of the membrane. The cryostat, including accessories i.e. the
sample holder, were cleaned with 70% ethanol. Brushes for
cryosectioning and a glass cuvette with ice cold acetone were
put in the cryostat and thereafter the UV-light in the cryostat was
switched on for 30 min. 10 μm thick sections were mounted on
frame slides and fixed in ice cold acetone for 2 min. The frame
slide was then dried with cold air before storage in an RNase free
50 ml tube (Ambion, LifeTechnologies Europe BV, Stockholm,
Sweden) in -80°C.
The frame slide with pancreas sections was thawed for 30 s
before hydration in nuclease free water (Ambion) for 30 s. RNase
free hematoxylin (Arcturus® HistoGene® Staining Solution, Applied
Biosystems, Foster City, CA, USA) was applied to the sections for 90
s and washed away with nuclease free water for 30 s.

Figure 1: Representative images of Congo red staining on pancreatic sections from healthy cat (A) and diabetic cat (B). Islets in the diabetic cats
stained positively with Congo red.
The sections were then dehydrated in 70% ethanol for 30 s, in 95% ethanol
for 30 s, and finally in absolute ethanol for 30 s. The frame slide
was air dried before laser microdissection performed with a
Leica LMD6000 B microscope (Leica Microsystems). Islets were
identified with both bright field and fluorescence (Figure 2 and
3). The cutting parameters with a 20x objective were set on:
laser power 25, aperture 17, speed 20 and specimen balance
25. Approximately 2 million μm2 of islet tissue was selected for
each sample (two separate samples were collected from each cat)
and approximately 2 million μm2 of exocrine pancreatic tissue
was collected from healthy cat nr 1. The laser microdissected
samples were collected in 65 μl of lysis buffer (RNeasy Plus Micro
Kit, Qiagen, Hilden, Germany) in the cap of a 0.5 ml RNase free
microfuge tube (Ambion) during cutting. Thereafter, lysis buffer
was added up to 350 μl and vortexed thoroughly before storage
in -80°C.
RNA isolation
Total RNA was isolated from the laser microdissected feline
islets according to the manufacturer’s instructions (RNeasy
Plus Micro Kit, Qiagen AB). Note that this kit contains a gDNA
Eliminator spin column, which will remove the genomic DNA. The
amount and purity (OD 260/280) of the total RNA was determined
using a NanoDrop 2000C spectrophotometer (Thermo Scientific,
Wilmington, DE, USA). Yields of the LMD samples were in the
range of 20-26 nanogram RNA. All RNA samples had OD 260/280
between 1.9 and 2.1, which is in the range for pure RNA. Due to
the limited amount of isolated RNA, no further quality controls could be included. The extracted total RNA was dissolved in
nuclease free water and stored at -80°C until cDNA synthesis.
Total RNA from two sets of laser microdissected islets from each
cat was isolated.
cDNA synthesis
The RNA was transcribed to cDNA by Superscript First-Strand
Synthesis Super Mix for qRT-PCR (Invitrogen, Life Technologies,
Stockholm, Sweden) according to the manufacturer’s instructions.
Briefly, a mix of random hexamer primers and oligo (dT) primers
were incubated with the Superscript III Reverse Transcriptase
enzyme mix and RNA at 25°C for 10 min, followed by 50°C for 30
min and thereafter 85°C for 5 min to inactivate the enzyme. To
remove the RNA template from the cDNA:RNA hybrid molecule
after first-strand synthesis, the mixture was incubated with two
units of RNaseH at 37°C for 20 min. The cDNA was stored at
-20°C until use for qPCR. Two independent reverse transcriptase
reactions were carried out for each RNA sample.
Primers
Primer pair selection criteria were set to generate short
amplicons of 71-220 base pairs (bp) with an annealing
temperature of 60°C and without predicted dimer formation
using Primer BLAST (NCBI). For primer sequences used in this
study see Table 1. The primers were purchased from Sigma-
Aldrich and dissolved in nuclease free water (Ambion). A stock
solution of each primer of 100 μM was prepared. From the stock
solution, a working dilution of 10 μM was prepared.
Figure 2: Micrographs of frozen pancreatic tissue from healthy cat
RNase free hematoxylin staining visualizing islets (marked with green line) in (A). Only selected area is laser microdissected (B). With fluorescence,
the islets are clearly distinguished from connective tissue (C). Insulin (brown) is visualized with DAB (D). Scale bars represent 100 μm.
Quantitative real-time PCR
The qPCR assay was performed using a Light Cycler 480t (Roche
Diagnostic, Mannheim, Germany) and Light Cycler FastStart DNA
Master PLUS SYBR Green I kit (Roche Diagnostic) for detection.
The final reaction volume of 10 μl contained 0.5 μM of each primer,
2 μl 5x Light Cycler FastStart DNA Master PLUS SYBR Green mix, 5
μl water and 0.5 ng of cDNA. In the Non-Template Control (NTC),
cDNA was substituted with nuclease free water. Samples without
reverse transcriptase were also included. The qPCR reactions
were carried out using an initial step of 10 min at 95°c; to activate
the Taq polymerase, followed by 45 cycles consisting of 10 s at
95°C, 5 s at 55°C, and elongation at 72°C, 10 s. The fluorescence
was measured at the end of each cycle. A melting curve analysis
was performed directly following PCR by continuously reading
the fluorescence while slowly heating the reactions from 65°C to
95°C. All qPCR samples were run in duplicates. Moreover, cDNA
was prepared twice from each RNA sample to ensure inter run
specificity. In summary, all samples were run in quadruplicates
per gene and RNA preparation, and thus eight samples per cat.
To determine the PCR efficiency, the primer pairs were analyzed
using a dilution curve with ten-fold cDNA template dilutions
between 2 ng/μl and 0.02 ng/μl. The efficiency was calculated
using the formula: Efficiency = -1+10(-1/slope). As markers for islets,
we selected the genes insulin (INS), Pancreatic and Duodenal
Homeobox 1 (PDX1), Chromogranin A (CHGA), Islet Cell Antigen 2
(IA-2) and Islet Amyloid Polypeptide (IAPP) (Table 2). Pancreatic
Lipase (PNLIP) was selected as a marker for exocrine pancreatic
tissue. The expression stability of reference transcripts Beta-
Actin (ACTB), Glyceraldehyde-3-phosphatase Dehydrogenase
(GAPDH) and Ribosomal Protein 7 (RPS7) was evaluated using
the Normfinder software [22]. The results are presented as
Threshold Cycle values (Ct-values). The Ct-values were used to
calculate the amount of PCR product compared with reference genes by subtracting the Ct-value for reference genes from the Ctvalue
for the gene studied (ΔCt). Relative mRNA expression was
calculated as 2-ΔCt. Data are expressed as means of two islet LMD
preparations from each cat ± SEM.
Agarose gel-electrophoresis
To confirm amplicon size, qPCR products were analyzed by
electrophoresis using a 3% agarose gel (PCR-grade, Bio-Rad,
Hercules, CA, USA). The PCR products were mixed with 5x loading
buffer (Bio-Rad) before loading. A 50 bp ladder (Invitrogen) was
used to determine the size of the PCR products. Electrophoresis
was conducted using an electrical field of 5 V/cm for 80 min and the
bands were visualized using GelRed (Biotium, Hayward, CA, USA)
and detected using the Chemi Doc MP Imaging System (Bio-Rad).
Immunohistochemistry
Separate frozen pancreas sections were mounted on polysine
coated glass slides (Thermo Scientific) and stored in the -80°C
freezer. Sections were fixed in zinc fixative (IHC Zinc fixative
(formalin free), BD Pharmingen, San Diego, CA, USA) for 10
min in room temperature before peroxidase blocking (Dako
REAL Peroxidase-Blocking Solution, Glostrup, Denmark) for 5
min and thereafter protein block (Background Sniper, Biocare
Medical, Concord, CA, USA) for 10 min. Sections were incubated
with primary antibody (Guinea pig polyclonal insulin antibody,
dilution 1:400, Fitzgerald, Concord, MA, USA) overnight in the
refrigerator. A Horseradish Peroxidase (HRP) polymer system
was used according to the manufacturer´s instructions (MACH 3
Rabbit HRP Polymer detection, Biocare Medical). Sections were
developed in Diaminobenzidine (DAB) and counterstained with
hematoxylin. After dehydration, sections were mounted with
pertex (Histolab, Göteborg, Sweden). Dako wash buffer was used
in all wash steps.
Table 1:Feline primer data.
Gene |
Oligo |
Sequence (5´-3´) |
Amplicon size (bp) |
ACTB |
forward reverse |
GTGGATCAGCAAGCAGGAGT CACTTGCCAGGGCAAACCTA |
136 |
GAPDH |
forward reverse |
GCCATCAATGACCCCTTCAT
GCCGTGGAATTTGCCGT |
82 |
RPS7 |
forward reverse |
AAAATCCAAGTCCGGCTCGT
TCACACGGATTCTCTTGCCC |
220 |
INS1 |
forward reverse |
CATCGTGGAGCAATGCTGTG
GCGCCCTCTAGTTGCAGTAA |
71 |
IAPP |
forward reverse |
AGAAGCAATGTGCCTCCTGA
AGAAATTTGCCAGGCGTTGG |
152 |
IA-2 |
forward reverse |
CCAAGGGCTCAGGACGAAAT
GATCCAGAGATCAGCACCCG |
190 |
CHGA |
forward reverse |
ACACACTATCCAAGCCCAGC
GGCACCTTGGAGAGCAAGAT |
137 |
PDX1 |
forward reverse |
AAGTCTACCAAGGCTCACGC
TGCGTGTCCGTTTGTTTTCC |
85 |
PNLIP |
forward reverse |
CAAACAAGTGCTTCCCCTGC
TTCCTTCCAGACAGCGTGAC |
172 |
Table 2:Specifications of the tested feline genes including reference genes.
Gene |
Name |
Function |
GenBank Acc. Nr. |
ACTB |
beta-Actin |
Major cytoskeletal protein |
XM_003997266 |
CHGA |
Chromogranin A |
Secreted protein produced by endocrine cells |
XM_003987967 |
GAPDH |
Glyceraldehyde 3-phosphate dehydrogenase |
Glycolytic enzyme |
NM_001009307 |
IA-2 |
Islet cell antigen 2, receptor-type tyrosine-protein phosphatase-like N isoform 2 |
Receptor-type tyrosine-protein phosphatase |
XM_003991192 |
IAPP |
Islet amyloid polypeptide |
Secreted peptide produced by beta cells |
NM_001043338 |
INS |
Insulin |
Peptide hormone, lowers blood glucose |
NM_001009272 |
PDX1 |
Pancreatic and duodenal homeobox 1 |
Transcription factor, beta cell differentiation marker |
XM_003980305 |
RPS7 |
Ribosomal protein S7 |
Ribosomal protein |
NM_001009832 |
PNLIP |
Pancreatic lipase
|
Enzyme produced in exocrine pancreas |
XM_006938207 |

Figure 3: Micrographs of frozen pancreatic tissue from diabetic cat
RNase free hematoxylin staining visualizing islets (marked with green line) in (A). Only selected area is laser microdissected (B). Islets are visualized
by fluorescence with a Texas Red filter (C). Insulin (brown) is visualized with DAB (D). Scale bars represent 100 μm.
Results
Laser microdissection of islets and immunohistochemistry
By the use of RNase-free hematoxylin to stain frozen
pancreatic cat tissue for 90 seconds, we were able to identify islets
for laser microdissection (Figure 2A and 3A). We found that islets
showed fluorescence visualized with a Texas Red filter (Figure 2C
and 3C). Connective tissue, which also showed fluorescence, was
distinguished from islets by its characteristic fibrous appearance.
The selected islets could therefore be distinctly cut out without visible contamination with exocrine pancreatic tissue (Figure 2B
and 3B). Separate pancreatic sections from adjacent areas used
to stain for insulin with Immunohistochemistry (IHC) revealed
high insulin content in islets of healthy cats (Figure 2D) whereas
less insulin-positive cells were found in diabetic cats (Figure 3D).
Specificity of the islet-specific genes used in the qPCR
assay
Primers for qPCR were designed using PrimerBlast (NCBI).
The specificity of each primer pair (Tables 1 and 2) was verified
by melting curve analysis followed by gel-electrophoresis. A single specific peak in the melting curve from each primer pair
indicates that the qPCR has only amplified one product (data not
shown). The detected Melting Temperatures (Tm) had a PCR
product-specific variation of less than 0.3°C. All qPCR reactions
were then analyzed by agarose gel-electrophoresis (Figures 4A
and 4B), which confirmed that each primer pair was specific
for the cDNA. A single band at the expected size of the amplicon
for each primer pair could be detected. The non-template
control where the cDNA was substituted with water, confirms
the absence of primer dimers (data not shown). In the samples
where the reverse transcription step was omitted, no amplified
product could be detected (data not shown). This confirms that
genomic DNA did not interfere with the PCR results.
Efficiency of the PCR
To determine the PCR efficiency, the primer pairs were
further analyzed using a dilution curve with ten-fold cDNA
template dilutions between 2 ng/μl and 0.02 ng/μl. The PCR
efficiency of the primer pairs was determined to be in the range
of 90 to 100% (data not shown).
Transcript levels of islet-specific genes
The normalization analysis, using the Normfinder software,
indicated that the best normalization was obtained by using
the geometric mean of the expression of the reference genes
GAPDH and RPS7. This normalization was used to compare
the islet-specific transcripts in all samples. To characterize the
islets collected by laser microdissection from two healthy and
two diabetic cats, the normalized mRNA expression levels of
INS, PDX1, CHGA, IA-2 and IAPP were determined (Figure 5) and
compared. Within and between run variations were found to be
low/moderate and reproducible results were obtained.
Purity of islet preparation
In order to investigate the purity of the LMD islets we
performed qPCR on healthy cat nr 1 using the primers for PNLIP.
It is highly expressed in the exocrine tissue of the pancreas but is expressed at very low levels in islets [23]. The islet sample was
compared to an LMD sample of exocrine pancreatic tissue.
The signal for the exocrine control gene PNLIP was 82 times
higher in the exocrine tissue compared to islets. This indicates
that the islet preparation contains less than 1.2% exocrine cells
(Figure 6).
Discussion
In the present study, we demonstrate that laser
microdissection allows distinct isolation of pancreatic islets from
both healthy and diabetic cats, with preserved RNA integrity for
further studies, i.e. gene expression profiling. Feline islets have
been considered particularly difficult to isolate with standard
collagenase protocols due to a lack of peri-islet matrix, and
previous isolation attempts have resulted in islets surrounded by
a rim of exocrine tissue [10,11,24]. It is advantageous to minimize
the amount of exocrine tissue contamination when performing
gene expression studies on pancreatic islets.
In order to prevent degradation of RNA we tried to keep the
staining protocol as short as possible. We found that a staining
time of 90 s was optimal for visualization of islets, as compared
to the slightly shorter staining protocols used for isolation of
rodent islets [17,25], or as in human islet laser microdissection,
where the intrinsic autofluorescence of human β-cells allows
isolation without prior staining [13-15]. The autofluorescence
of rodent β-cells is not strong enough to be useful for LMD [17],
and although we found fluorescence of stained feline islets using
the Texas red filter, this fluorescence was not strong enough to
be used without staining of slides to allow for identification and
isolation of islets.
We found mRNA expression of all islet-specific genes, as well
as the reference genes, in all our samples. As markers for islets,
we selected the genes INS, PDX1, CHGA, IA-2 and IAPP. Since islets
in majority consist of beta cells [9], we wanted to investigate the
mRNA levels of insulin. PDX1 is a transcription factor, which is
important in the maturation and survival of beta cells [26], CHGA is

Figure 4: Specificity of the reference genes and islet-specific genes used in the qPCR assay
qPCR products from the reference genes visualized on a 3% agarose gel stained with GelRed. Each primer pair was subjected to PCR using reverse
transcribed total RNA as template. All primer pairs generated a single product of the predicted size. Arrows indicate DNA molecular ladder (bp). (A)
Lane 1: primer for RPS7 (220 bp). Lane 2: primer for GAPDH (82 bp). Lane 3: primer for ACTB (136 bp). (B) Lane 1: primers for INS (71 bp). Lane 2:
primers for IAPP (152 bp). Lane 3: primers for CHGA (137 bp). Lane 4: primers for PDX1 (85 bp). Lane 5: primers for IA-2 (190 bp).

Figure 5: Relative mRNA transcript levels in laser microdissected feline islets from healthy and diabetic cats
Relative gene expression for INS (A), PDX1 (B), IAPP (C), IA-2 (D) and CHGA (E) in two healthy and two diabetic cats. Values are normalized to the
geometric mean of the reference genes RPS7 and GAPDH. Data are expressed as means of two islet LMD preparations from each cat ± SEM.

Figure 6: Purity of islet preparation
(A) Specificity of the exocrine pancreatic gene used in the qPCR assay and relative mRNA transcript levels in laser microdissected feline islets and
exocrine pancreatic tissue. qPCR product from the exocrine gene visualized on a 3% agarose gel stained with GelRed. The primer pair was subjected to
PCR using reverse transcribed total RNA as template. The primer pair generated a single product of the predicted size. Arrows indicate DNA molecular
ladder (bp). Lane 1: primer for PNLIP (172 bp). (B) Relative gene expression for PNLIP in islets and exocrine tissue from healthy cat no 1. Values are
normalized to the reference gene RPS7.
a general marker for endocrine cells, whereas IA-2, (also referred
as Islet Cell Autoantigen (ICA) 512) is an islet-specific membrane
protein found in all islet endocrine cells [27]. Moreover, IA-2 is
also well known as a diabetes-specific autoantigen [28]. CHGA
and IA-2 were included in our study in case we could not detect
the mRNA levels of insulin in the diabetic cats. Aggregates of IAPP
result in amyloid formation in islets, which is found in diabetic
cats, as well as in humans with T2DM [8]. Congo red staining on pancreatic sections from diabetic cats confirmed presence
of amyloid in islets, whereas islets from healthy cats were not
stained with Congo red.
Great care was taken to only include the visible islets
themselves in the laser microdissection while carefully avoiding
exocrine tissue, and by cutting out all islets under direct
surveillance. Moreover, PNLIP was included in the study as an exocrine control. Our islet preparation was found to be pure with
as low as 1.2% of exocrine cells.
One of the diabetic cats (nr.1) showed, as expected, a lower
expression of insulin compared to both healthy cats, whereas
the other diabetic cat (nr. 2) showed expression of insulin in
the same range as the healthy cats. This could be explained by
the first cat being in a later stage of the disease, with a declining
insulin secretion; whereas the second cat was more recently
diagnosed and may still have had a normal insulin production.
Measuring circulating serum insulin levels may help elucidate
these observations, and no conclusions could be drawn from this
finding due to the small number of cats included in the study.
Immunohistochemistry was used to confirm presence of
insulin-positive cells in pancreatic specimens. We found, not
surprisingly, that these cells were more abundant in healthy
cats than in diabetic cats. The immunohistochemistry slides
were prepared from sections in close proximity to the laser
microdissected sections and thus help verifying the presence and
location of islets.
Laser microdissection allows distinct studies of islets with
minimal contamination of acinar cells. Our results demonstrate
that laser microdissected islets both from healthy and diabetic
cats can effectively be utilized for quantitative PCR studies.
Future studies using LMD and q-PCR will help define expression
profiles of healthy and diabetic cats. We are currently recruiting
additional healthy and diabetic cats in order to expand the study
and investigate a larger set of genes important in islet function.
Differences in gene expression between healthy and diabetic cats
may reveal underlying mechanisms for beta cell dysfunction and
decreased beta cell mass in human T2DM.
Acknowledgement
The study was generously supported by the Swedish
Juvenile Diabetes Foundation, the Fredrik and Ingrid Thuring´s
Foundation, the Magnus Bergvall´s Foundation, the Lars Hierta’s
Memorial Foundation, and the Foundation for Research, Agria
Insurance Company and the Swedish Kennel Club. We thank Erika
Karlstam (DVM, Dipl. ECVP), for the post-mortem examinations.
- Cefalu WT. Animal models of type 2 diabetes: Clinical presentation
and pathophysiological relevance to the human condition. ILAR J.
2006; 47(3): 186-98.
- Henson MS, O’Brien TD. Feline models of type 2 diabetes mellitus.
ILAR J, 2006; 47(3): 234-42.
- Linsenmeier RA, Braun RD, McRipley MA, Padnick LB, Ahmed J,
Hatchell DL, et al. Retinal hypoxia in long-term diabetic cats. Invest
Ophthalmol Vis Sci. 1998; 39(9): 1647-57.
- Mizisin AP, Shelton GD, Burgers ML, Powell HC, Cuddon PA, et al.
Neurological complications associated with spontaneously occurring
feline diabetes mellitus. J Neuropathol Exp Neurol. 2002; 61(10): 872-
84.
- Johnson KH, Hayden DW, O’Brien TD, Westermark P, et al. Spontaneous diabetes mellitus-islet amyloid complex in adult cats. Am J Pathol.
1986; 125(2): 416-9.
- Lutz TA, Rand JS. Detection of amyloid deposition in various regions
of the feline pancreas by different staining techniques. J Comp Pathol.
1997; 116(2): 157-70.
- Butler AE, Janson J, Bonner-Weir S, Ritzel R, Rizza RA, Butler PC, et
al. Beta-cell deficit and increased beta-cell apoptosis in humans with
type 2 diabetes. Diabetes. 2003; 52(1): 102-10.
- Ma Z, Westermark GT, Johnson KH, O’Brien TD, Westermark P, et
al. Quantitative immunohistochemical analysis of islet amyloid
polypeptide (IAPP) in normal, impaired glucose tolerant and diabetic
cats. Amyloid. 1998; 5(4): 255-61.
- O’brien TD, Hayden DW, Johnson KH, Fletcher TF.
Immunohistochemical morphometry of pancreatic endocrine-cells in
diabetic, normoglycemic glucose-intolerant and normal cats. J Comp
Pathol. 1986; 96(4): 357-69.
- Zini E, Franchini M, Guscetti F, Osto M, Kaufmann K, Ackermann
M, et al. Assessment of six different collagenase-based methods to
isolate feline pancreatic islets. Res Vet Sci. 2009; 87(3): 367-72. doi:
10.1016/j.rvsc.2009.03.017
- Maeno T, Inoue M, Embabi SN, Miki D, Hatchell DL. Islet-like cell
clusters: viability, cell types, and subretinal transplantation in
pancreatectomized cats. Lab Anim. 2006; 40(4): 432-46.
- Franchini M, Zini E, Osto M, Jablonski K, Kaufmann K, Lutz TA, et al.
Feline pancreatic islet-like clusters and insulin producing cells express
functional Toll-like receptors (TLRs). Vet Immunol and Immunopathol.
2010. 138(1-2): 70-78. doi: 10.1016/j.vetimm.2010.07.001.
- Marselli L, Thorne J, Ahn YB, Omer A, Sgroi DC, Libermann T, et al.
Gene expression of purified beta-cell tissue obtained from human
pancreas with laser capture microdissection. J Clin Endocrinol Metab.
2008; 93(3): 1046-53.
- Marselli L, Sgroi DC, Bonner-Weir S, Weir GC. Laser capture
microdissection of human pancreatic beta-cells and RNA preparation
for gene expression profiling. Methods Mol Biol. 2009; 560: 87-98. doi:
10.1007/978-1-59745-448-3_8.
- Marselli L, Thorne J, Dahiya S, Sgroi DC, Sharma A, Bonner-Weir S, et
al, Gene Expression Profiles of Beta-Cell Enriched Tissue Obtained by
Laser Capture Microdissection from Subjects with Type 2 Diabetes.
PLoS One. 2010; 5(7). e11499. doi: 10.1371/journal.pone.0011499.
- Laybutt DR, Kaneto H, Hasenkamp W, Grey S, Jonas JC, Sgroi DC, et
al, Increased Expression of Antioxidant and Antiapoptotic Genes
in Islets That May Contribute to beta-Cell Survival During Chronic
Hyperglycemia. Diabetes. 2002; 51(2): 413-23.
- Dreja T, Jovanovic Z, Rasche A, Kluge R, Herwig R, Tung YC, et al. Dietinduced
gene expression of isolated pancreatic islets from a polygenic
mouse model of the metabolic syndrome. Diabetologia. 2010; 53(2):
309-20. doi: 10.1007/s00125-009-1576-4.
- Sturm D, Marselli L, Ehehalt F, Richter D, Distler M, Kersting S, et al.
Improved protocol for laser microdissection of human pancreatic
islets from surgical specimens. J Vis Exp. 2013; 71: 50231. doi:
10.3791/50231.
- Rios L, Ward C. Feline diabetes mellitus: diagnosis, treatment, and
monitoring. Compend Contin Educ Vet. 2008; 30(12): 626-39.
- Puchtler H, Sweat F, Levine M. On the binding of Congo red by amyloid.
J Histochem Cytochem. 1962; 10(3): 355-64. doi: 10.1177/10.3.355
- Furuzawa Y, Ohmori Y, Watanabe T. Immunohistochemical
morphometry of pancreatic islets in the cat. J Vet Med Sci, 1992; 54(6):
1165-73.
- Andersen CL, Jensen JL, Ørntoft TF. Normalization of Real-Time
Quantitative Reverse Transcription-PCR Data: A Model-Based
Variance Estimation Approach to Identify Genes Suited for
Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer
Res. 2004; 64(15): 5245-50.
- Eizirik DL, Sammeth M, Bouckenooghe T, Bottu G, Sisino G, Igoillo-
Esteve M, et al. The human pancreatic islet transcriptome: expression
of candidate genes for type 1 diabetes and the impact of proinflammatory
cytokines. PLoS Genet, 2012. 8(3): 1002552. doi:
10.1371/journal.pgen.1002552.
- Zini E, Franchini M, Osto M, Vögtlin A, Guscetti F, Linscheid P, et al.
Quantitative real-time PCR detection of insulin signalling-related
genes in pancreatic islets isolated from healthy cats. Vet J. 2010; 183(3): 287-93. doi: 10.1016/j.tvjl.2008.11.012.
- Jermendy A, Toschi E, Aye T, Koh A, Aguayo-Mazzucato C, Sharma A, et
al. Rat neonatal beta cells lack the specialised metabolic phenotype of
mature beta cells. Diabetologia. 2011; 54(3): 594-604. doi: 10.1007/
s00125-010-2036-x.
- Fujimoto K, Polonsky KS. Pdx1 and other factors that regulate
pancreatic beta-cell survival. Diabetes Obes Metab. 2009; 11 Suppl 4:
30-7. doi: 10.1111/j.1463-1326.2009.01121.x.
- Solimena, M, Dirkx R Jr, Hermel JM, Pleasic-Williams S, Shapiro JA,
Caron L, et al. ICA 512, an autoantigen of type I diabetes, is an intrinsic
membrane protein of neurosecretory granules. EMBO J. 1996; 15(9):
2102-14.
- Rabin DU, Pleasic SM, Shapiro JA, Yoo-Warren H, Oles J, Hicks JM, et al.
Islet-cell antigen-512 is a diabetes-specific islet autoantigen related
to protein-tyrosine phosphatases. J Immunol. 1994; 152(6): 3183-88.