2Tel Hai College, Upper Galilee 12210, Israel
3Department of Plant Pathology and Microbiology, The Robert H. Smith Faculty of Agriculture, Food and Environment, The Hebrew University of Jerusalem, Rehovot 76100, Israel
4University of Louisville, Department of Pathology, Louisville, KY 40202, USA
Keywords: Glucans; Inflammation; Inflammatory Bowel Disease; Pleurotus eryngii
Glucans activate a biological response, partially, by specific binding to lectin-binding site of complement receptor type III (CR3 (CD11b/CD18)) on immune effector cells. Dectin-1, also known as β-glucan receptor, recognizes β-(1, 3) linkage and plays an important role in anti-fungal infection. Dectin-1 is expressed on natural killer cells, dendritic cells, macrophages, monocytes, neutrophils and T cells. The dectin-1 activation signal mechanism promotes innate immune responses through activation of phagocytosis, ROS production mediated by triggering the transcription factor nuclear factor-κB (NF-κB) to induce cytokine and chemokine synthesis [5, 10]. Nitric oxide is a small free radical secreted by activated macrophages and functions as a well-known inflammatory mediator. It has been previously demonstrated that β-glucans can significantly reduce NO production in activated macrophages [2, 9, 11-14].
Nuclear factor-κB is a protein considered to participate in one of the most well-established proinflammatory signaling pathways and thus controls the expression of many inflammatory cytokines and chemokines; its expression and activation provides an important step in the inflammatory process including the intestinal inflammatory pathway [15-17].
Olive Oil Mill Solid Waste (OSMW) is the dry solid fraction that remains after water is removed from the waste product of olive oil production. We have recently demonstrated that increasing the fraction of OSMW in the growth substrate of P. eryngii induces a significant increase in the amount of total glucans and especially α-glucans produced by the edible mushroom. We also showed that the distribution is not equal between the different parts of the mushroom and that the P. eryngii mushroom stalks accumulated more glucans than caps [18]. Our findings show a dose response-dependent increase in glucan production as a function of % OSMW increases in the substrate.
Inflammatory Bowel Diseases (IBD) are divided into two major types; Crohn’s disease and ulcerative colitis. Both diseases exhibit an overactive immune response in the gastrointestinal tract. IBD are chronic diseases causing a dramatic reduction of the quality of life and substantial health costs. Treatment of IBD can be targeted by non-specific immunosuppressive therapiessteroids, antibiotics- or alternatively by biological therapies. The latter consists of targeting specific proinflammatory mediators including Tumor Necrosis Factor (TNF) and cytokines [19]. Such treatments are not always effective and sometimes include severe adverse side effects.
The aim of the present study was to investigate the antiinflammatory effect of glucans extracted from stalks of P. eryngii grown of on substrate supplemented with 20% OSMW as compared to 80% OSMW. We assessed the effect of the extracted glucans in vitro on both intestinal epithelial cells and cells of the immune system and in-vivo using the Dextran Sodium Sulfate (DSS) induced colitis in mice.
Luciferase activity (fold) = ratio of firefly/renilla luciferase reading (each sample) / average of the ratio of firefly/renilla reading (Control).
Primer name |
Forward |
Reverse |
TNF-α |
GTCTGTGCCTCAGCCTCTTC |
GCTTGGTGGTTTGCTACGAC |
IFN-γ |
5' CTGGACCTGTGGGTTGTTGAC 3' |
5' CTGGACCTGTGGGTTGTTGAC 3' |
IL-1β |
5' CATCAGAGGCAAGGAGGAAAAC 3' |
5' CATCAGAGGCAAGGAGGAAAAC 3' |
IL-6 |
5' TTGCCATTGCACAACTCTTTTC 3' |
5' TTGCCATTGCACAACTCTTTTC 3' |
IL-12 |
5' GAAGCTGGTGCTGTAGTTCTCATATTT 3' |
5' GAAGCTGGTGCTGTAGTTCTCATATTT 3' |
GAPDH |
5' TCCCATTCTCGGCCTTGAC 3' |
5' TCCCATTCTCGGCCTTGAC 3' |
The Cytokine array was scanned with a gene microarray laser scanner. Densitometry and analysis was performed according to the established Ray Biotech protocol.
Values of most of the cytokines values measured in the plasma of mice treated with DSS were upregulated except for IL-10, which is expected since it has anti-inflammatory effects and IL-9 which also has been shown to induce anti-inflammatory effects or alternatively induce resolution of inflammation.
Additionally, cytokines values measured in the plasma from mice treated with DSS together with glucans extracted from P. eryngii stalks grown on 80 % OMSW were closer to the range of Control mice.
Effect of pre incubation of IEC-6 cells with glucans and assessment of Nf-κB induction followed by TNFα activation, effect on TNF-α, and iNOS transcripts. a; Real Time PCR of TNF-α gene expressed by IEC-6 cells followed by treatments. b; Luciferase activity in response to NF-κB activation by TNF-α. c; Real Time PCR of iNOS gene expressed by IEC-6 cells. Bars represent four biological repetitions and values represent mean ± SEM. In a and in c **** indicate significant difference compared to control (P < 0.0001) in b letters indicate statistical significance between all groups (P < 0.0001)
Nitrate production (μM) was measured in J774A.1 macrophages pretreated with glucan extracts (18h) and stimulated with LPS (2h). Bars represent four repetitions and values represent mean ± SEM. Letters represent significant difference between groups (P < 0.0001)
One of the most important determinants resulting from DSS-treatment in order to induce acute colitis mice is enhanced intestinal damage as evidenced by assessing histologic damage score of the large intestine. Figure 4 and Figure 5a clearly demonstrate that the histologic damage score is significantly higher as a consequence of DSS treatment in C57BL/6 mice. Glucan extracts prepared from P. eryngii grown on 20% OSMW and commercial glucans significantly reduced histology damage compared to only DSS treatment alone. Colon shortening is also a known phenomenon resulting from DSS treatment during DSSinduced colitis (See Figure 5b). While treatment with the various glucan preparations did not completely recover the original loss in colon length compared to control, nonetheless, all glucan treatments attenuated colon shortening (Figure 5b).
Control and only DSS treated groups were not fed glucans throughout the whole experiment. Mice were fed Glucans extracted from P. eryngii grown on 80% and 20% OSMW or commercial α-glucan (Pullulan) from the first day. After 7 days, DSS was administered in the drinking water (3% w/v) to induce colitis in following groups: DSS, 80% OSMW + DSS, 20% OSMW +DSS and commercial α-glucan + DSS
Control mice; Mice fed glucans extracted from mushrooms grown on 20 % OMSW; Mice fed glucans extracted from mushrooms grown on 80 % OMSW; Mice fed Pullulan; dextran sodium sulfate (DSS)-treated mice; DSS-treated mice fed glucans extracted from mushrooms grown on 20 % OMSW; DSStreated mice fed glucans extracted from mushrooms grown on 80 % OMSW; DSS-treated mice fed Pullulan
A; DSS-treated C57BL/6 mice fed with glucans prepared from P. eryngii grown on 20% OSMW and commercial α-glucan significantly reduced histology damage compared to only DSS treatment. B; All orally administrated glucans attenuated colon shortening induced by DSS treatment. Bars represent N = 5 in non-DSS-treated groups and N = 10 in DSS-treated groups. Values represent mean ± SEM. A; asterisks represent significant difference from control, * P < 0.0153, ** P < 0.003; *** P< 0.0001 B; Different letters represent significant difference between all groups P < 0.0001
a; IL-12 relative expression, b; IL-6 relative expression, c; MCP-1 relative expression,. Glucans were administered per os 7 days prior to DSS treatment. N=5 bars represent mean ± SEM. Statistical analysis in all figures compared treatments to control. a * P < 0.0360; ** P < 0.086, b P < 0.0205, c P < 0.0001
Relative gene expression in the colon of INF-γ and IL1-β as quantified by Real time PCR, is shown in a and c. Chemokine secretion quantified by ELISA is shown in b and d. Bars represent mean ± SEM; N=5. B-c significance was calculated between all groups except in a where all groups were compared to control. a and b P < 0.0001 c. P < 0.001, d P < 0.007
The harvested medium was removed and initially assayed for several cytokines measured by the Mouse Cytokine Array G2, Ray Biotech (Table 3). These initial results led us to focus on INF-γ and IL1-β using ELISA (see methods). The secreted chemokines were compared to extent of gene expression in the colon. Both the gene expression and secretion of IL-1β and INF-γ were significantly increased by DSS induced colitis (Figure 8). Expression of INF-γ was reduced by pretreatment with glucan extracts to the same levels of control yet chemokines secreted in the colon showed less reduction (Figure 8a & 8b). In IL1-β the expression and secretion profile were similar. Pretreatment with glucan extracts results in reduced expression and secretion of both INF-γ and IL1-β.
Additionally, plasma cytokine levels were also analyzed for various cytokines and the results are summarized in Table 3. These results essentially indicate that DSS treatment affects dramatically the plasma cytokine profile of mice as compared to control and most of all cytokines and chemokines evaluated are up regulated. Mice treated with glucans prepared from P. eryngii mushrooms stalks grown on 80% OSMW and DSS have diminished plasma cytokine levels as compared to DSS. Additionally, it is evident that mice treated only with glucans prepared from P. eryngii mushrooms stalks grown on 80% OSMW show some priming of the immune response. The results are only indicative since the values obtained results from densitometry assessments.
Cytokine |
Control densitometry |
DSS densitometry |
80% OMSW densitometry |
80% OMSW+DSS densitometry |
CTACK |
774 |
4,858 |
1,158 |
1,373 |
GCSF |
563 |
713 |
676 |
509 |
GM-CSF |
444 |
33,135 |
3,096 |
13,126 |
IL-2 |
435 |
782 |
686 |
681 |
IL-3 |
442 |
899 |
620 |
761 |
IL-4 |
467 |
740 |
619 |
561 |
IL-5 |
507 |
889 |
714 |
715 |
IL-6 |
575 |
771 |
692 |
717 |
IL-9 |
772 |
777 |
760 |
717 |
IL-10 |
899 |
712 |
1,329 |
1,185 |
IL-12 p40p70 |
661 |
1,229 |
1,115 |
755 |
IL-12p70 |
652 |
712 |
535 |
604 |
IL-13 |
411 |
774 |
588 |
612 |
IL-17 |
453 |
1,006 |
814 |
760 |
IFN-γ |
498 |
596 |
489 |
514 |
KC |
319 |
482 |
511 |
590 |
Leptin |
348 |
1,029 |
925 |
493 |
MCP-1 |
717 |
941 |
790 |
800 |
MCP-5 |
677 |
635 |
426 |
541 |
MIP-1a |
383 |
827 |
760 |
696 |
MIP-2 |
539 |
639 |
446 |
574 |
MIP-3 b |
467 |
1,148 |
827 |
661 |
RANTES |
496 |
709 |
750 |
675 |
SCF |
450 |
8,638 |
3,454 |
3,880 |
TARC |
575 |
1,085 |
770 |
924 |
TNF-α |
535 |
851 |
790 |
733 |
Thrombopoietin |
670 |
744 |
638 |
671 |
We then measured the effect of the extracted glucan samples on the expression of Nf-κB in rat epithelial cells (IEC-6). Nf-κB mediates a plethora of cellular immune-regulatory responses [15, 23]. Cells were pretreated with glucans before the induction with TNF-α. As expected, TNF-α dramatically upregulated the expression of luciferase located upstream to Nf-κB enhancer element (Figure 1b). IEC-6 transfected cells pre-treated with glucans extracted from P. eryngii grown on 80% OSMW significantly reduced activation of Nf-κB. Additionally, TNF-α gene expression was down regulated by pretreatment with both glucans extracted from P. eryngii stalks grown on substrate containing 80% and 20% OSMW.
Nitric Oxide production is a characteristic event following pathogen attack and concomitant inflammation. Nitric Oxide expression is activated via the Nf-κB pathway [29]. Indeed, TNF-α triggered more than 6-fold the increase in expression of the iNOS gene. Pre-incubation with glucan extracts significantly reduced the expression iNOS only with glucans extracted from P. eryngii grown on 20% OSMW. This emphasizes the complexity of the effects of glucans on the inflammatory process and the resulting differential genetic response to stimulation/inhibition mediated by glucans.
During active colitis or other IBD stages, the intestinal activated macrophages induce severe injury of the intestinal epithelium. Nitric oxide is a characteristic event of activated macrophages. We simulated in vitro this event when we treated macrophages with LPS in vitro and measured induced NO production increase by ~6 fold as a result of LPS treatment. Glucans reduced LPS induced NO significantly; however glucans harvested from P. eryngii grown on 80% OSMW exhibited a stronger inhibition of NO production compared to glucans from P. eryngii grown on 20% OSMW (16.5 μM ± 1.5 and 8 μM ± 3.8 respectively, see Figure 2). Our findings in conjunction with other reports showing inhibition of NO production in LPS-activated macrophages incubated with glucans demonstrate the important immune-modulating effects of glucans, especially those harvested from P. eryngii edible mushrooms [9, 14, 30, 31].
We recently conducted an in-vivo study in which we induced IBD in BALB/c mice via treatment with DSS [8]. This study demonstrated that the expression of the inflammation gene markers MIP-2, TNF-α, INF-γ, CXCL1 and iNOS were significantly reduced in mice treated with glucan extracts, additionally we showed that the number of activated monocytes were significantly reduced in glucan treated mice [8]. DSS induces severe colitis in mice model, however the extent and characterization of the inflammation differs between mice strains [32]. BALB/c mice show recovery in body weight, inflammatory score, diarrhea score, colonic damage and inflammatory cytokines short after cessation of DSS administration [33]. Under the same conditions C57BL/6 develop chronic inflammation subsequent to the acute response with cytokine levels remaining high even after cessation of DSS administration [33]. Therefore, comparison of the results of our previous study conducted in Balb/c mice to the results of the present study conducted in C57BL/6 allows to appreciate the effects of glucans in mice suffering from DSS-induced IBDinflammation at different degrees [8].
In the present study, glucans treatment shows some protective properties on the colon length and the histological damage score on DSS induced colitis (Figure 4 & 5). Nevertheless, glucan pretreatment did not induce the recovery of colon lengths to the levels of untreated control (Figure 5b). Our data indicate that the expression of inflammatory cytokines MIP-2, TNF-α, IL-12 and IL-6 were not reduced in glucan treatments compared to control (data not shown); we demonstrate that INF-γ and IL-1β protein levels in intestinal samples were reduced yet not significantly in most of the treatments (Figure 8). Changes in gene expression as measured by q-PCR were more robust for INF-γ expression and less for IL-1β.
Cumulatively, the results of the present study demonstrate that pretreatment of C57BL/6 mice with glucan extracts from P. eryngii cultivated on either 20 % OMSW or 80 % OMSW reduces inflammation in DSS induced acute colitis. Due to the severity of inflammation as a result of DSS treatment of C57BL/6 mice our results were not as conclusive as our previous studies performed by similar glucan extracts on BALB/c mice emphasizing the importance of stage of inflammation when treating with glucans [8].
- Ma G, Kimatu BM, Zhao L, Yang W, Pei F, Hu Q. Impacts of Dietary Pleurotus eryngii Polysaccharide on Nutrient Digestion, Metabolism, and Immune Response of the Small Intestine and Colon-An iTRAQ-Based Proteomic Analysis. Proteomics. 2018;18(7):e1700443. Doi: 10.1002/pmic.201700443
- Kim YH, Jung EG, Han KI, Patnaik BB, Kwon HJ, Lee HS, et al. Immunomodulatory Effects of Extracellular beta-Glucan Isolated from the King Oyster Mushroom Pleurotus eryngii (Agaricomycetes) and Its Sulfated Form on Signaling Molecules Involved in Innate Immunity. Int J Med Mushrooms. 2017;19(6):521-533. Doi: 10.1615/IntJMedMushrooms.v19.i6.40
- Lavi I, Friesem D, Geresh S, Hadar Y, Schwartz B. An aqueous polysaccharide extract from the edible mushroom Pleurotus ostreatus induces anti-proliferative and pro-apoptotic effects on HT-29 colon cancer cells. Cancer Lett. 2006;244(1):61-70.
- Legentil L, Paris F, Ballet C, Trouvelot S, Daire X, Vetvicka V, et al. Molecular Interactions of beta-(1-->3)-Glucans with Their Receptors. Molecules. 2015;20(6):9745-9766. Doi: 10.3390/molecules20069745
- Schwartz B, Hadar Y. Possible mechanisms of action of mushroom-derived glucans on inflammatory bowel disease and associated cancer. Ann Transl Med. 2014;2(2):19. Doi: 10.3978/j.issn.2305-5839.2014.01.03
- Lavi I, Levinson D, Peri I, Nimri L, Hadar Y, Schwartz B. Orally administered glucans from the edible mushroom Pleurotus pulmonarius reduce acute inflammation in dextran sulfate sodium-induced experimental colitis. Br J Nutr. 2010;103(3):393-402. Doi: 10.1017/S0007114509991760
- Lavi I, Nimri L, Levinson D, Peri I, Hadar Y, Schwartz B. Glucans from the edible mushroom Pleurotus pulmonarius inhibit colitis-associated colon carcinogenesis in mice. J Gastroenterol. 2012;47(5):504-518. Doi: 10.1007/s00535-011-0514-7
- Vetvicka V, Gover O, Hayby H, Danay O, Ezov N, Hadar Y, et al. Spatial Distribution of Glucan Type and Content between Caps and Stalks in Pleurotus eryngii: Impact on the Anti-inflammatory Functionality. Int J Mol Sci. 2018;19(11). pii: E3371. Doi: 10.3390/ijms19113371
- Akramiene D, Kondrotas A, Didziapetriene J, Kevelaitis E. Effects of beta-glucans on the immune system. Medicina (Kaunas). 2007;43(8):597-606.
- Jin Y, Li P, Wang F. β-glucans as potential immunoadjuvants: A review on the adjuvanticity, structure-activity relationship and receptor recognition properties. Vaccine. 2018;36(35):5235-5244. Doi: 10.1016/j.vaccine.2018.07.038
- Chan GC, Chan WK, Sze DM. The effects of beta-glucan on human immune and cancer cells. J Hematol Oncol. 2009;2:25. Doi: 10.1186/1756-8722-2-25
- Loures FV, Araujo EF, Feriotti C, Bazan SB, Costa TA, Brown GD, et al. Dectin-1 induces M1 macrophages and prominent expansion of CD8+IL-17+ cells in pulmonary Paracoccidioidomycosis. J Infect Dis. 2014;210(5):762-773. Doi: 10.1093/infdis/jiu136
- Pietretti D, Vera-Jimenez NI, Hoole D, Wiegertjes GF. Oxidative burst and nitric oxide responses in carp macrophages induced by zymosan, MacroGard® and selective dectin-1 agonists suggest recognition by multiple pattern recognition receptors. Fish Shellfish Immunol. 2013;35(3):847-857. Doi: 10.1016/j.fsi.2013.06.022
- Xu X, Yasuda M, Mizuno M, Ashida H. β-Glucan from Saccharomyces cerevisiae reduces lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. Biochim Biophys Acta. 2012;1820(10):1656-1663. Doi: 10.1016/j.bbagen.2012.06.015
- Liu T, Zhang L, Joo D, Sun SC. NF-κB signaling in inflammation. Signal Transduct Target Ther. 2017;2. pii: 17023. Doi: 10.1038/sigtrans.2017.23
- Lawrence T. The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb Perspect Biol. 2009;1(6):a001651. Doi: 10.1101/cshperspect.a001651
- Chun J, Lee C, Hwang SW, Im JP, Kim JS. Ursolic acid inhibits nuclear factor-kappaB signaling in intestinal epithelial cells and macrophages, and attenuates experimental colitis in mice. Life Sci. 2014;110(1):23-34. Doi: 10.1016/j.lfs.2014.06.018
- Avni S, Ezove N, Hanani H, Yadid I, Karpovsky M, Hayby H, et al. Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii. Int J Mol Sci. 2017;18(7). pii: E1564. Doi: 10.3390/ijms18071564
- Yamamoto-Furusho JK. Inflammatory bowel disease therapy: blockade of cytokines and cytokine signaling pathways. Curr Opin Gastroenterol. 2018;34(4):187-193. Doi: 10.1097/MOG.0000000000000444
- Chen Lf, Fischle W, Verdin E, Greene WC. Duration of nuclear NF-κB action regulated by reversible acetylation. Science. 2001;293(5535):1653-1657.
- Viennois E, Chen F, Laroui H, Baker MT, Merlin D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 2013;6:360. Doi: 10.1186/1756-0500-6-360
- Erben U, Loddenkemper C, Doerfel K, Spieckermann S, Haller D, Heimesaat MM, et al. A guide to histomorphological evaluation of intestinal inflammation in mouse models. Int J Clin Exp Pathol. 2014;7(8):4557-4576.
- Schutze S, Wiegmann K, Machleidt T, Kronke M. TNF-induced activation of NF-kappa B. Immunobiology. 1995;193:193-203.
- Deshmane SL, Kremlev S, Amini S, Sawaya BE. Monocyte chemoattractant protein-1 (MCP-1): an overview. J Interferon Cytokine Res. 2009;29(6):313-326. Doi: 10.1089/jir.2008.0027
- Krawisz JE, Sharon P, Stenson WF. Quantitative assay for acute intestinal inflammation based on myeloperoxidase activity. Assessment of inflammation in rat and hamster models. Gastroenterology. 1984;87:1344-1350.
- Neurath MF, Weigmann B, Finotto S, Glickman J, Nieuwenhuis E, Iijima H, et al. The transcription factor T-bet regulates mucosal T cell activation in experimental colitis and Crohn's disease. J Exp Med. 2002;195:1129-1143.
- Powrie F, Leach MW, Mauze S, Menon S, Caddle LB, Coffman RL. Inhibition of Th1 responses prevents inflammatory bowel disease in scid mice reconstituted with CD45RBhi CD4+ T cells. Immunity. 1994;1:553-562.
- Snodgrass RG, Huang S, Choi IW, Rutledge JC, Hwang DH. Inflammasome-Mediated Secretion of IL-1β in Human Monocytes through TLR2 Activation; Modulation by Dietary Fatty Acids. J Immunol. 2013;191(8):4337-4347. Doi: 10.4049/jimmunol.1300298
- Arias-Salvatierra D, Silbergeld EK, Acosta-Saavedra LC, Calderon-Aranda ES. Role of nitric oxide produced by iNOS through NF-kappaB pathway in migration of cerebellar granule neurons induced by Lipopolysaccharide. Cell Signal. 2011;23(2):425-435. Doi: 10.1016/j.cellsig.2010.10.017
- Shi L, Lin Q, Yang T, Nie Y, Li X, Liu B, et al. Oral administration of Lentinus edodes beta-glucans ameliorates DSS-induced ulcerative colitis in mice via MAPK-Elk-1 and MAPK-PPARgamma pathways. Food Funct. 2016;7:4614-4627.
- Nayak BN, Kaur G, Buttar HS. TNF-alpha modulation by natural bioactive molecules in mouse RAW 264.7 macrophage cells. J Complement Integr Med. 2016;13(1):1-7. Doi: 10.1515/jcim-2015-0024
- Mahler M, Bristol IJ, Leiter EH, Workman AE, Birkenmeier EH, Elson CO, et al. Differential susceptibility of inbred mouse strains to dextran sulfate sodium-induced colitis. Am J Physiol. 1998;274(3):G544-G551. Doi: 10.1152/ajpgi.1998.274.3.G544
- Melgar S, Karlsson A, Michaelsson E. Acute colitis induced by dextran sulfate sodium progresses to chronicity in C57BL/6 but not in BALB/c mice: correlation between symptoms and inflammation. Am J Physiol Gastrointest Liver Physiol. 2005;288:G1328-G1338.
- Krawisz JE, Sharon P, Stenson WF. Quantitative assay for acute intestinal inflammation based on myeloperoxidase activity. Assessment of inflammation in rat and hamster models. Gastroenterology.1984;87(6):1344-1350.











