Research article
Open Access
The Anti-Obesity Effect of Kaempferia Parviflora (KP)
is Attributed to Leptin in Adipose Tissue
Masaya Miyazaki1, Nobuo Izumo2, Kaoru Yoshikawa2, Takuya Matsugami2, Yuko Miyadate2,
Kohsuke Hayamizu1, Yasuo Watanabe1, 2
1Dept of Functional food, Yokohama University of Pharmacy, 601 Matano-cho, Totsuka-ku, Yokohama, Kanagawa 245-0066, Japan
2General Health Medical Center, Yokohama University of Pharmacy, 601 Matano-cho, Totsuka-ku, Yokohama, Kanagawa, 245-0066, Japan
2General Health Medical Center, Yokohama University of Pharmacy, 601 Matano-cho, Totsuka-ku, Yokohama, Kanagawa, 245-0066, Japan
*Corresponding author:Yasuo Watanabe, General Health Medical Center, Yokohama University of Pharmacy 601 Matano-cho, Totsuka-ku, Yokohama,
Kanagawa 245-0066, Japan; E-mail:
@
Received: May 27, 2019; Accepted: June 24, 2019; Published: June 25, 2019
Citation: Yasuo W, Masaya M, Izumo N, Yoshikawa K, et al. (2019) The Anti-Obesity Effect of Kaempferia Parviflora (KP) is Attributed to Leptin in Adipose Tissue. J Nutrition Health Food Sci 7(2):1-9. DOI: 10.15226/jnhfs.2019.001158
Abstract
Kaempferia parviflora (KP) (black ginger) is a plant in Thailand
known historically as Kurachai Dam. It belongs to the ginger family and
was used as a remedy medicine. Its rhizomes were used to improve
obesity, blood flow, inflammation, allergy, and gastrointestinal
disorders. However, the mechanism of its anti-obesity effect has not
been elucidated. In this study, our purpose was to explore the visceral
fat reduction mechanism of KP in vivo. Five weeks old C57BL/6J male
mice were used. The mice were fed for 8 weeks with a test food limited
to 3 g/day/mouse. We divided the mice into 4 groups as follows: ①
normal diet group (controls), ② high fat diet group (HFD), ③ high
fat diet + 0.5% black ginger extract group (HFD + KP 0.5%), and ④
high fat diet + black ginger extract 1.0% group (HFD + KP 1.0%). At
the end of the 8th week, the visceral fat of the mice was collected and
weighed and the expression levels of adiponectin, leptin, IL-6, and
IL-1β in adipose tissues were measured by RT-PCR. Leptin and IL-6
expressions were decreased with a significant difference between
group 4 and group 2. Adiponectin expression was significantly
higher in group 4 than in group 2. The present study indicated that
the anti-obesity effect of KP in vivo normalizes the function of leptin
by suppressing its resistance upon ingestion of high-fat meals and
inhibits fat accumulation by thermogenesis in brown adipocytes.
Keywords: Kaempferia parviflora, anti-obesity, leptin, adiponectin, adipose tissue, C57BL/6J mice
Keywords: Kaempferia parviflora, anti-obesity, leptin, adiponectin, adipose tissue, C57BL/6J mice
Introduction
In recent years, obesity has been regarded as a serious health
problem worldwide, including in Japan. Many Japanese develop
dietary problems, although Japanese people genetically do not
have a tendency for obesity. However, due to the wide spread of
European and American food culture, Japanese food habits have
changed from “Japanese style food,” containing considerable
dietary fibers, to “Western style food,” mainly consisting of animal
fat, resulting in an increase in obesity rate among the Japanese
population.
Obesity is a state in which body fat is accumulated to an excessive extent and may be the cause of the onset of diabetes, dyslipidemia, hypertension, gout, cholelithiasis, osteoporosis, and other diseases. As obesity progresses, other severe, diseases appear that are difficult to treat or manage, including angina, ischemic heart disease, stroke, and malignant tumors. It has been also reported that the hypertrophy of adipocytes and inflammation can cause insulin resistance and obesity, resulting in increased leptin and decreased adiponectin secretions [1-3]. Therefore, as obesity is closely related to various diseases, its prevention has a very important impact in alleviating these dietrelated diseases.
Kaempferia parviflora (KP) is a plant belonging to the family Zingiberaceae and is grown specifically in Thailand and Laos. It has historically been well known as Kurachai Dum in Thailand and was used as a traditional remedy. Unlike ginger, the rhizomes of KP are black. The rhizome was used to improve obesity, inflammation, allergy, and gastrointestinal disorders [4-6]. In addition, it has been reported that KP extract (KPE) has various properties, including anti-obesity effects, anti-oxidant and antiinflammatory activity, and the capacity to reinforce skeletal muscles [7-11].
Dietary supplementation with KPE in obese mice reportedly suppresses body weight increases, body fat accumulation, and glucose intolerance [12-14]. Other reports suggest that oral intake of KPE increases energy expenditure and fat utilization in humans [15, 16]. Moreover, dietary intake of KPE reportedly decreases body fat (visceral and subcutaneous fat) in overweight and pre-obese subjects [17]. Collectively, these findings suggest that KPE could be used to reduce body fat in humans. However, its precise mechanism of action has not been elucidated yet.
In this study, we tried to explore the visceral fat reduction mechanism of KP in vivo.
Obesity is a state in which body fat is accumulated to an excessive extent and may be the cause of the onset of diabetes, dyslipidemia, hypertension, gout, cholelithiasis, osteoporosis, and other diseases. As obesity progresses, other severe, diseases appear that are difficult to treat or manage, including angina, ischemic heart disease, stroke, and malignant tumors. It has been also reported that the hypertrophy of adipocytes and inflammation can cause insulin resistance and obesity, resulting in increased leptin and decreased adiponectin secretions [1-3]. Therefore, as obesity is closely related to various diseases, its prevention has a very important impact in alleviating these dietrelated diseases.
Kaempferia parviflora (KP) is a plant belonging to the family Zingiberaceae and is grown specifically in Thailand and Laos. It has historically been well known as Kurachai Dum in Thailand and was used as a traditional remedy. Unlike ginger, the rhizomes of KP are black. The rhizome was used to improve obesity, inflammation, allergy, and gastrointestinal disorders [4-6]. In addition, it has been reported that KP extract (KPE) has various properties, including anti-obesity effects, anti-oxidant and antiinflammatory activity, and the capacity to reinforce skeletal muscles [7-11].
Dietary supplementation with KPE in obese mice reportedly suppresses body weight increases, body fat accumulation, and glucose intolerance [12-14]. Other reports suggest that oral intake of KPE increases energy expenditure and fat utilization in humans [15, 16]. Moreover, dietary intake of KPE reportedly decreases body fat (visceral and subcutaneous fat) in overweight and pre-obese subjects [17]. Collectively, these findings suggest that KPE could be used to reduce body fat in humans. However, its precise mechanism of action has not been elucidated yet.
In this study, we tried to explore the visceral fat reduction mechanism of KP in vivo.
Materials and Methods
Animals
We obtained 5-week-old male C57BL/6J mice from SLC
(Shizuoka, Japan) to the animal experimental facility in Yokohama
University of Pharmacy and bred them under controlled
conditions of temperature (22 ± 3°C), humidity (55 ± 15%) and
light (0700-1900 h) for 8 weeks. Dietary intake and body weight
were measured daily. The visceral fat and subcutaneous fat were
measured by X-ray CT scan (La Theta, Aloka, Tokyo) once per
week. On the last day of the 8-week period, we removed the liver
and the visceral adipose tissue (testicle, mesenteric, perirenal)
after 24 h fasting. This study was conducted with the approval
of the Animal Experiment Committee of Yokohama University of
Pharmacy.
Test Food
The rhizomes of KP from Thailand were washed thoroughly
in water, dried and powdered. The rhizome powder was extracted
with 50% ethanol, evaporated in vacuo and freeze-dried to obtain
a dry extract. All mice were fed normal diets (CE-2, CLEA Japan,
Inc. Tokyo) for one week to permit acclimation to the environment,
and then they were divided into 4 groups (n= 5-8 in each group)
according to their diet as follows: ① control feed group fed diet
containing 10 Kcal% fat (Research Diet, Inc. D12450B), ②high
fat feed group (HFD) fed diet containing 60 Kcal% fat (Research
Diet, Inc. D12492), ③HF+ KP 0.5% group (KP 0.5%) fed high fat
diet plus 0.5% KP extract and ④HF+ KP 1.0% group fed high fat
diet plus 1.0% KP extract. Food was administered at a rate of 3 g
daily by a gauge individually for each animal.
Biochemical Analysis
The blood was collected in heparinized tubes and centrifuged
at 3,000 rpm at 4 °C for 15 minutes, after which plasma was
collected. Plasma concentrations of glucose, cholesterol, NEFA,
and insulin were determined using an E-Test Wako system (Wako
Pure Chemical Industries, Ltd., Osaka).
X-Ray Computed Tomography (CT) Analysis
Mice were injected with 10 mL/kg pentobarbital diluted 10x
at the peritoneal cavity. The mice were anesthetized, and after
confirmation of loss of reflexes, visceral and subcutaneous fat
were observed by CT scanning once a week. A series of CT images
of tissue fat was scanned at slices of 1.0 mm thickness.
Histopathological Study
Liver and tissue epididymal fat was obtained from all animals
and fixed with 10% neutral buffered formalin solution, embedded
in paraffin, and sectioned at 3 μm width slices. Hematoxylin-Eosin
(HE) solution was used for tissue staining. The stained tissues
were observed under a light microscope (magnification: ×400).
Real-Time PCR
For total RNA extraction, Isogen (Nippon Gene Co., Ltd., Tokyo)
was added to the extracted fat from each mouse and homogenized
with POLYTRON-PT 1300 D (Central Scientific Trade Co., Ltd.,
Tokyo). Chloroform (Nacalai Tesque, Inc., Kyoto) was added to the
homogenate; after centrifugation, the supernatant was recovered
in a new tube. Isopropanol (Nacalai Tesque Co., Ltd., Kyoto)
was added to the supernatant and after another centrifugation,
the precipitate was recovered and dissolved in sterilized water
and RNA concentration was measured. cDNA was obtained
according to the protocol of Super Script VIRO cDNA Synthesis
Kit (Invitrogen, Thermo Fisher Scientific Inc.). After completion
of the reverse transcription PCR, we proceeded to Real Time
PCR for leptin, adiponectin, IL-6, and IL-1β, with GAPDH as an
internal standard using the Light Cycler 480 system (Roche,
Basel, Switzerland) [18, 19] Table 1.
Table 1:Each primer for real-time PCR
Gene |
Universal Probe Library |
Forward (Left) |
Reverse (Right) |
GAPDH |
#9 |
AGCTTGTCATCAACGGGAAG |
TTTGATGTGGGGTCTCG |
ADIPONECTIN |
#95 |
ACCGGCAGACAAGAGCAG |
TGGTGGGTACAACACCACTC |
LEPTIN |
#45 |
GTGGTGGCTGGTGTCAGATT |
TTGATGAGGTGACCAAGGTG |
TNF-a |
#103 |
TGCTGGGAAGCCTAAAAGG |
CGAATTTTGAGAAGATGATCCTG |
IL-6 |
#60 |
TCTTCCTAAAGTATGGGCTGGA |
AAAGGGAGCTCCTTAACATGC |
Statistical Analysis
Each result was represented as mean ± standard error (SE).
Statistical analyses among the control, HF, and KP groups were
carried out using Tukey-Kramer test and t test with a significance
level of 0.05 (P< 0.05) or 0.001 (P< 0.001). These data were
analyzed using software Excel statistics.
Results
Effects of KP on Body Weight Variation
In the HFD group, body weight gain was significantly higher
than that in the control group 1 week after the start of the
experiment, whereas body weight in the KP 1.0% group was
significantly lower at the 3rd week than that in the HFD group,
and this effect continued until the final day of the study. The body
weight on the final day was 22.1 ± 0.29 g in the control group,
28.4 ± 0.26 g in the HFD group, 27.7 ± 0.21 in the KP 0.5% group,
and 26.3 ± 0.3 g in the KP 1.0% group Figure 1. There were no
significant differences in feeding rate among the groups Figure 2.
Figure 1: Effects of KP on variations in body weight. In the HFD group the body weight increased compared to the control group with a significant difference the first week of the study, and KP 1.0% inhibited the body weight gain in C57BL/6J mice 3-weeks after the initiation of the study #p< 0.05vs control, *p< 0.05 vs HFD
Figure 2: Effects of KP on feeding rates. There was no difference in the feeding rates in all groups
Weight of Total Visceral Fat
The weight of visceral fat was 0.32±0.07 g in the control
group, 1.75±0.14 g in the HFD group, 1.54±0.18 g in the KP 0.5%
group, and 1.22±0.10 g in the KP 1.0% group. The weight of total
visceral fat in the KP 1.0% group was significantly less than that
in the HFD group Figure 3.
Figure 3: Effect of KP on the weight of the total visceral fat (testis, renal, and mesenteric) the 8th week after the initiation of the study. There was a significant increase in visceral fat in the HFD group compared to the control group, and KP 1.0% significantly inhibited the increase of visceral fat. Each value the mean ± SE #p< 0.05 vs control, *p< 0.05 vs HFD
Image analysis of visceral and subcutaneous fat by
X-ray CT
After the first 2 weeks an increase in visceral fat was observed
in the HFD group with significant difference compared to the
control group, and this result remained the same until the end of
the study. The KP 1% group showed significantly lower visceral
fat at the 4th week than the HFD group, and this result remained
unaltered until the end of the study Figure 4. The subcutaneous fat
was increased in the HFD group at the 3rd week with a significant
difference compared to the control group. In the KP 1.0% group,
a decrease in the subcutaneous fat was observed with significant
difference compared to the HFD group at the 6th week Figure 5.
This is an image of visceral fat and subcutaneous fat obtained
from X-ray CT analysis at 0-week, 5-week and 8-week.
At the beginning of the study, there was no difference between the 4 groups. In the CT image of the 5th week, a decrease was apparent in both visceral and subcutaneous fat in the KP 1.0% group compared to that in the HFD group. In the CT image at the 8th week, the decreases in visceral and subcutaneous fat were obviously confirmed in both KP 0.5% and KP 1.0% groups compared to the HFD group Figure 6.
At the beginning of the study, there was no difference between the 4 groups. In the CT image of the 5th week, a decrease was apparent in both visceral and subcutaneous fat in the KP 1.0% group compared to that in the HFD group. In the CT image at the 8th week, the decreases in visceral and subcutaneous fat were obviously confirmed in both KP 0.5% and KP 1.0% groups compared to the HFD group Figure 6.
Figure 4: Time course of the effect of KP on visceral fat by CT measurements. Significant increase in visceral fat was observed in the HFD group the 2nd week after the initiation of the study, and significant decrease in visceral fat in the KP 1.0% group compared to the HFD group the 4th week after the initiation of the study #p< 0.05 vs control *p< 0.05 vs HFD
Figure 5: Time course of the effect of KP on subcutaneous fat by CT measurements. Significant increase in subcutaneous fat was observed in the HFD group 3 weeks after the initiation of the study and significant decrease in subcutaneous fat in the KP group compared to that in the HFD group 6 weeks after the initiation of the study #p< 0.05 vs control. *p< 0.05 vs HFD
Figure 6: X-ray CT image of viscera fat and subcutaneous fat at 8 weeks after intake of fat meal. In the CT images, the viscera fat appears red and the subcutaneous fat yellow
Histopathological Study
KP significantly decreased the adipocyte size Figure 7A. In
histological analysis, the adipocyte’s size of the HFD group was
larger than that of the normal diet group. However, the KP 1.0%
group showed significant decrease in adipocyte size compared
to the HFD group. To observe the effect of KP on fat volume,
we used micro-CT analysis to quantify it. The results showed
that the HFD group exhibited larger fat volume than the normal
diet group, suggesting that the KP considerably lowered the fat
volume. The HFD group had significantly higher adipose tissue
weight than the normal diet group; however, the KP 1.0% group
had also decreased adipose tissue weight. These results indicate
that the oral administration of KP reduces the adipocyte size and
fat volume, leading to a significant reduction in fat accumulation.
There were no differences in the liver weight in all groups. In
histopathological analysis, the KP 1.0% group had significantly
lower incidence of fat accumulation in the liver than the HFD
group Figure 7B.
Figure 7: Effects of KP on adipocyte size and liver fat accumulation. Representative HE stained epididymal adipose tissue and liver (magnification,×400)
The Expression Level of Visceral Adipose Tissue Markers
The mRNA expression levels of visceral fat markers were
measured by RT-PCR at the end of the study. Gene expression
levels were normalized to the expression level of the GAPDH gene
and were compared to the expression level of HFD group.
The adiponectin gene expression level was 2.72±0.13 in the control group, 2.60±2.02 in the KP 0.5% group, and 8.58±1.64 in the KP 1.0% group. The expression level of adiponectin was significantly lower in the HFD group than in the control group, and significantly higher in the HFD than in the KP 1.0% group Figure 8A.
The leptin gene expression level was 0.0058±0.0049 in the control group, 0.57±0.11 in the KP 0.5% group, and 0.20±0.0064 in the KP 1.0% group. The expression level of leptin was significantly higher in the HFD group than in the control group, and significantly lower in the HFD group than in the KP 1.0% group Figure 8B. The IL-6 gene expression level was 0.19±0.043 in the control group, 0.037±0.031 in the KP 0.5% group, and 0.080±0.040 in the KP 1.0% group. The expression level of IL-6 was significantly increased in the HFD group compared to the control group, and the KP groups, in both the 0.5% group and the 1.0% group, were significantly decreased compared to the HFD group Figure 8C. IL-1β gene expression level was 0.16±0.071 in the control group, 0.71±0.26 in the HFD KP 0.5% group, and 0.64±0.10 in the KP 1.0% group. In the HFD group, the expression level of IL-6 was significantly higher than that in the control group, but there was no significant difference from that in the KP group; only a decreasing trend was observed Figure 8D.
The adiponectin gene expression level was 2.72±0.13 in the control group, 2.60±2.02 in the KP 0.5% group, and 8.58±1.64 in the KP 1.0% group. The expression level of adiponectin was significantly lower in the HFD group than in the control group, and significantly higher in the HFD than in the KP 1.0% group Figure 8A.
The leptin gene expression level was 0.0058±0.0049 in the control group, 0.57±0.11 in the KP 0.5% group, and 0.20±0.0064 in the KP 1.0% group. The expression level of leptin was significantly higher in the HFD group than in the control group, and significantly lower in the HFD group than in the KP 1.0% group Figure 8B. The IL-6 gene expression level was 0.19±0.043 in the control group, 0.037±0.031 in the KP 0.5% group, and 0.080±0.040 in the KP 1.0% group. The expression level of IL-6 was significantly increased in the HFD group compared to the control group, and the KP groups, in both the 0.5% group and the 1.0% group, were significantly decreased compared to the HFD group Figure 8C. IL-1β gene expression level was 0.16±0.071 in the control group, 0.71±0.26 in the HFD KP 0.5% group, and 0.64±0.10 in the KP 1.0% group. In the HFD group, the expression level of IL-6 was significantly higher than that in the control group, but there was no significant difference from that in the KP group; only a decreasing trend was observed Figure 8D.
Figure 8: Effect of KP on mRNA expression level measured by PCR at the 8th week mRNA expression was normalized by GAPDH mRNA. A: Adiponectin expression levels significantly increased in the KP 1.0% group compared to HFD group. B: Leptin expression levels significantly decreased in KP 1.0% group compared to HFD group. C: IL-6 expression levels significantly decreased in the KP group compared to HFD group. D: Expression levels of IL- 1β showed a tendency of decrease in the KP group compared to HFD group. Each value shows the mean ± SE #p< 0.05 vs control *p< 0.05 vs HFD
Discussion
The purpose of this study was to explore the mechanism of
anti - obesity effect of KP. This study was breed individual gage
with mice and them freely ingested. Approximately 70% of 4.5 g,
the usual amount of mice daily food intake, was normally fed to
the mice.
In the obesity mouse model, the suppression of obesity increase was shown in the KP 1.0% group. Although the feed intake of the KP group was the same as that of the target group, the KP group significantly prevented body weight gain and visceral fat and liver lipid accumulation. In addition, with respect to adipocytokines, a significant decrease in leptin and a significant increase in adiponectin were observed in the KP 1.0% group, as well as a significant decrease in levels of the inflammatory marker IL-6.
Previous reports have shown that KP effectively attenuated obesity and insulin resistance by suppression of fat accumulation, hyperinsulinemia, glucose intolerance, hypertension, and insulin resistance in type 2 diabetic mice [12]. These results indicate that KP can improve the obesity related to metabolic dysfunctions and insulin sensitivity in obese mice.
Serum levels of hepatotoxic biomarkers were not measured in this study; however, liver weight was not significantly altered among groups, which indicates a probable protective effect of KP. Hepatic fat accumulation induced by high fat diet leads to increase of hepatotoxic biomarkers, which may cause fatty liver disease and hepatic inflammation resulting in imbalance in lipid metabolism [18]. KP reduces hepatic fat accumulation thus preventing the obesity induced hepatic injury.
The present study shows that KP exerts an anti-obesity effect. KP effectively prevents body weight gain, reduce fat size and mass, and attenuates hepatic fat accumulation without any liver damage in obese mice.
Adiponectin is a hormone secreted from adipose tissue that regulates glucose and lipid metabolism by stimulating fatty acid oxidation in almost all major target tissues, including skeletal muscle, liver and adipocytes [19-21].
Blood levels of leptin are positively correlated with increase in obesity and weight in humans and rodents [22, 23]. It has been reported that with a high fat diet, blood leptin concentration augments and leptin resistance can be developed [24, 25].
It has been also reported that there is a decrease in the secretion of adiponectin in high fat diets [26]. In this study, the expression level of adiponectin was significantly higher in the KP 1.0% group than in the HFD group, and the expression level of leptin was significantly lower in the KP 1.0% group than in the HFD group.
The 4-week administration of KP had no effect on adiponectin; however, significantly higher leptin levels were observed in the KP group than in the HFD group (unpublished data).
Previous reports have stated that KP is involved in thermogenesis in brown adipocytes [14, 27]. It has also been reported that leptin activates Uncoupling protein 1 (UCP-1) of BAT by activating sympathetic nerves that secrete noradrenaline, enhancing the capacity for thermo genesis and the energy consumption of individuals [28-30].
From the above data, it is suggested that KP enhances lipolysis by the β receptor (β-AR) system and consumption by the UCP by improving leptin resistance and is involved in fat reduction.
In the obesity mouse model, the suppression of obesity increase was shown in the KP 1.0% group. Although the feed intake of the KP group was the same as that of the target group, the KP group significantly prevented body weight gain and visceral fat and liver lipid accumulation. In addition, with respect to adipocytokines, a significant decrease in leptin and a significant increase in adiponectin were observed in the KP 1.0% group, as well as a significant decrease in levels of the inflammatory marker IL-6.
Previous reports have shown that KP effectively attenuated obesity and insulin resistance by suppression of fat accumulation, hyperinsulinemia, glucose intolerance, hypertension, and insulin resistance in type 2 diabetic mice [12]. These results indicate that KP can improve the obesity related to metabolic dysfunctions and insulin sensitivity in obese mice.
Serum levels of hepatotoxic biomarkers were not measured in this study; however, liver weight was not significantly altered among groups, which indicates a probable protective effect of KP. Hepatic fat accumulation induced by high fat diet leads to increase of hepatotoxic biomarkers, which may cause fatty liver disease and hepatic inflammation resulting in imbalance in lipid metabolism [18]. KP reduces hepatic fat accumulation thus preventing the obesity induced hepatic injury.
The present study shows that KP exerts an anti-obesity effect. KP effectively prevents body weight gain, reduce fat size and mass, and attenuates hepatic fat accumulation without any liver damage in obese mice.
Adiponectin is a hormone secreted from adipose tissue that regulates glucose and lipid metabolism by stimulating fatty acid oxidation in almost all major target tissues, including skeletal muscle, liver and adipocytes [19-21].
Blood levels of leptin are positively correlated with increase in obesity and weight in humans and rodents [22, 23]. It has been reported that with a high fat diet, blood leptin concentration augments and leptin resistance can be developed [24, 25].
It has been also reported that there is a decrease in the secretion of adiponectin in high fat diets [26]. In this study, the expression level of adiponectin was significantly higher in the KP 1.0% group than in the HFD group, and the expression level of leptin was significantly lower in the KP 1.0% group than in the HFD group.
The 4-week administration of KP had no effect on adiponectin; however, significantly higher leptin levels were observed in the KP group than in the HFD group (unpublished data).
Previous reports have stated that KP is involved in thermogenesis in brown adipocytes [14, 27]. It has also been reported that leptin activates Uncoupling protein 1 (UCP-1) of BAT by activating sympathetic nerves that secrete noradrenaline, enhancing the capacity for thermo genesis and the energy consumption of individuals [28-30].
From the above data, it is suggested that KP enhances lipolysis by the β receptor (β-AR) system and consumption by the UCP by improving leptin resistance and is involved in fat reduction.
Conclusion
This study has shown that KP exerts an anti-obesity action
by improving leptin resistance preventing effectively body
weight gain, decreasing fat size and body weight, and hepatic fat
accumulation without liver damage. The present study indicates
that the anti-obesity effect of KP in vivo normalizes the function
of leptin by suppressing the induction of leptin resistance upon
ingestion of high-fat meals and inhibits fat accumulation by
thermogenesis in brown adipocytes.
Authors’ Contributions
MM, KY, TM and YM performed most of the experiments.
NI gave many advices during the research. KH gave many
helpful suggestions on the statistical analysis. YW designed the
experiments. All authors read and approved the final manuscript.
Availability of Data and Materials
The datasets used and/or analyzed during the current study
are available from the corresponding author on reasonable
request.
Ethics approval and consent to participate
NA
Clinical Trial Registration
NA
Acknowledgement
The authors are thankful to dear friends, Mr. Yu Kuwahara, Mr.
Jun Sakurai and Mr. Kazuto Homma, students of Functional Food,
Yokohama University of Pharmacy, for their helpful assistances to
prepare for this experiment.
Funding
Annual Research Grant from Yokohama University of
Pharmacy
ReferencesTop
- Kadowaki T, Yamauchi T. Adiponectin and adiponectin receptors. Endocrine Reviews. 2005;26(3):439-451.
- Kadowaki T, Yamauchi T, Kubota N, Hara K, Ueki K, Tobe K. Adiponectin and adiponectin receptors in insulin resistance, diabetes, and the metabolic syndrome. J Clin Invest. 2006;116(7):1784-1792. DOI: 10.1172/JCI29126
- Masuzaki H, Tanaka T, Ebihara K, Hosoda K, Nakao K. Hypothalamic melanocortin signaling and leptin resistance perspective of therapeutic application for obesity-diabetes syndrome. Peptides. 2009;30(7):1383-1386. DOI: 10.1016/j.peptides.2009.04.008
- Yenjai C, Prasanphen K, Daodee S, Wongpanich V, Kittakoop P. Bioactive flavonoids from Kaempferia parviflora. Fitoterapia. 2004;75(1):89-92.
- Tewtrakul S, Subhadhirasakul S. Anti-allergic activity of some selected plants in the Zingiberaceae family. J Ethnopharmacol. 2007;109(3):535-538.
- Toda K, Hitoe S, Takeda S, Shimoda H. Black ginger extract increases physical fitness performance and muscular endurance by improving inflammation and energy metabolism. Heliyon. 2016;2(5):e00115.
- Rujjanawate C, Kanjanapothi D, Amornlerdpison D, Pojanagararoon S. Anti-gastric ulcer effect of Kaempferia parviflora. J Ethnopharmacol. 2005;102(1):120- 122.
- Kusirisin W, Srichairatanakool S, Lerttrakarnnon P, Lailerd N, Suttajit M, Jaikang C, et al. Antioxidaive activity. polyphenolic content and anti-glycation effect of some Thai medicinal plants traditionally used in diabetic patients. Med Chem. 2009;5(2):139-147.
- Saokaew S, Wilairat P, Raktanyakan P, Dilokthornsakul O, Dhippayom T, Kongkaew C, et al. Clinical Effects of Krachaidum(Kaemferiapa parviflora): A Systematic Review. J Evid Based Complementary Altern Med. 2017;22(3):413-428. DOI: 10.1177/2156587216669628
- Tsuzuki S, Nakano M, Izumo N, Hayamizu K, Matsuyama M, Watanabe Y. Effects of the Oral Intake of Kaempferia parviflora Extract on Whole Body Fat and Skeletal Muscle Percentages in Japanese Women: Randomized Double-Blind Placebo-Controlled Parallel Group Comparison Study. Pharmacometrics. 2007;93(3/4) 55-62.
- Chen D, Li H, Li W, Feng S, Deng D. Kaemferiapa parviflora and Its Methoxyflavones: Chemistry and Biological Activities. Evidence-Based Complementary & Alternative Medicine. 2018;16(2018):4057456. DOI: 10.1155/2018/4057456
- Akase T, Shimada T, Terabayashi S, Ikeya Y, Sanada H, Aburada M. Antiobesity effects of Kaempferia parviflora in spontaneously obese type II diabetic mice. J Nat Med. 2011;65(1):73-80. DOI: 10.1007/s11418-010-0461-2
- Shimada T, Horikawa T, Ikeya Y, Matsuo H, Kinoshita K, Taguchi T, et al. Preventive effect of Kaempferia parvifloraethyl acetate extract and its major components polymethoxyflavonoid on metabolic diseases. Fitoterapia. 2011;82(8):1272-1278. DOI: 10.1016/j.fitote.2011.08.018
- Yoshino S, Kim M, Awa R, Kuwahara H, Kano Y, Kawada T. Kaemferiapa parviflora extract increases energy consumption through activation of BAT in mice. Food Sci Nutr. 2014;2(6):634-637. DOI: 10.1002/fsn3.144
- Matsushita M, Yoneshiro T, Aita S, Kamiya T, Kusaba N, Yamaguchi K, et al. Kaempferia parviflora Extract Increases Whole-Body Energy Expenditure in Humans: Roles of Brown Adipose Tissue. J Nutr Sci Vitaminol. 2015;61(1):79-83. DOI: 10.3177/jnsv.61.79
- Yoshino S, Awa R, Niyake Y, Kuwahara H, Akamatsu Y, Moritani T. Effects of Single Oral Intake of Kaempferia parviflora Extract on Energy Metabolism. Japanese Pharmacology & therapeutics. 2016;44:12.
- Yoshino S, Awa R, Miyake Y, Fukuhara I, Sato H, Ashino T, et al. Daily intake of Kaempferia parviflora extract decreases abdominal fat in overweight and pre obese subjects: a randomized, double-blind, placebo-controlled clinical study. Diabetes, Metabolic Syndrome and Obesity: Targets and Therapy. 2018;2018(11):447-458.
- Sakurai J, Izumo N, Watanabe Y. Effect of Coriandrum sativum L. Leaf Extract on n the Brain GABA Neurons in Mice. J Nutrition Health Food Sci. 2019;7(2):1-7. DOI: 10.15226/jnhfs.2019.001154
- Hirokawa Y, Izumo N, Hashimoto M, Tawara S, Mori H, Kuwahata K, et al. Anti-Obesity Effects of Sticky Japanese Diet (SJD) Assessed by Regulations of Leptin and Adiponectin. J Nutrition Health Food Sci. 2019;7(1):1-7. DOI: 10.15226/jnhfs.2018.001153
- Kim M, Kim C, Song Y, Hwang J. Antihyperglycemic and Anti-Inflammatory Effects of Standardized Curcuma xanthorrhiza Roxb. Extract and Its Active Compound Xanthorrhizol in High-Fat Diet-Induced Obese Mice. Evid Based Complement Alternat Med. 2014;2014:205915. DOI: 10.1155/2014/205915
- Chandran M, Phillips SA, Ciaraldi T, Henry RR. Adiponectin: more than just another fat cell hormone? Diabetes Care. 2003;26(8):2442-2450. DOI: 10.2337/diacare.26.8.2442
- Nigro E, Scudiero O, Monaco ML, Palmieri A, Mazzarella G, Costagliola C, et al. New insight into adiponectin role in obesity and obesity-related diseases. BioMed Research International. 2014;2014:658913. DOI: 10.1155/2014/658913
- Ohashi K, Yuasa D, Shibata R, Murohara T, Ouchi N. Adiponectin as a Target in Obesity-related Inflammatory State. Endocr Metab Immune Disord Drug Targets. 2015;15(2):145-150.
- Maffei M, Halaas J, Ravussin E, Pratley RE, Lee GH, Zhang Y, et al. Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Nat Med. 1995;1(11):1155-1161.
- Roujeau C, Jockers R, Dam J. New pharmacological perspectives for the leptin receptor in the treatment of obesity. Front Endocrinol (Lausanne). 2014;5:167. DOI: 10.3389/fendo.2014.00167
- Schwartz MW, Woods SC, Porte D, Seeley RJ, Baskin DG. Central nervous system control of food intake. Nature. 2000;404(6778):661-671.
- Flier JS, Maratos-Flier E. What fuels fat. Scientific American. 2007;297(3):72-81.
- Arita Y, Kihara S, Ouchi N, Takahashi M, Maeda K, Miyagawa J, et al. Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem Biophys Res Commun. 1999;257(1):79-83. DOI: 10.1006/bbrc.1999.0255
- Kobayashi H, Horiguchi-Babamoto E, Suzuki M, Makihara H, Tomozawa H, Tsubata M, et al. Effects of ethyl acetate of Kaempferia parviflora on brown adipose tissue. J Nat Med. 2016;70(1):54-61. DOI: 10.1007/s11418-015-0936-2
- Dimitriadis GK, Adya R, Tan BK, Jones TA, Menon VS, Ramanjaneya M, et al. Effects of visfatin on brown adipose tissue energy regulation using T37i cells. Cytokine. 2019;113:248-255. DOI: 10.1016/j.cyto.2018.07.013










